aat-9 | GeneID:190250 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 190250 Official Symbol aat-9
Locus Y53H1C.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description Amino Acid Transporter
Chromosome N/A
Also Known As Amino Acid Transporter family member (aat-9)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68710

ID Symbol Protein Species
GeneID:171814 aat-5 NP_491003.2 Caenorhabditis elegans
GeneID:177388 aat-4 NP_001023382.1 Caenorhabditis elegans
GeneID:185079 aat-8 NP_500425.2 Caenorhabditis elegans
GeneID:186240 aat-7 NP_493960.2 Caenorhabditis elegans
GeneID:188421 aat-6 NP_505905.2 Caenorhabditis elegans
GeneID:190250 aat-9 NP_001021788.1 Caenorhabditis elegans
GeneID:852946 MUP1 NP_011569.1 Saccharomyces cerevisiae
GeneID:2710414 NCU07754.1 XP_328460.1 Neurospora crassa
GeneID:2897160 KLLA0B13233g XP_452121.1 Kluyveromyces lactis
GeneID:4619036 AGOS_ABL003C NP_982944.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0015171 Function amino acid transmembrane transporter activity
GO:0006865 Process amino acid transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001026617 NP_001021788
2 NM_001026618 NP_001021789

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
Y53H1C.1a MI0000819 cel-miR-392 UAUCAUCGAUCACGUGUGAUGA
Y53H1C.1b MI0000819 cel-miR-392 UAUCAUCGAUCACGUGUGAUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Veljkovic E, et al. (2004) "Aromatic amino acid transporter AAT-9 of Caenorhabditis elegans localizes to neurons and muscle cells." J Biol Chem. 279(47):49268-49273. PMID:15364921
  2. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  3. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719