ABCA1 | GeneID:19 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 19 Official Symbol ABCA1
Locus N/A Gene Type protein-coding
Synonyms ABC-1; ABC1; CERP; FLJ14958; HDLDT1; MGC164864; MGC165011; TGD
Full Name ATP-binding cassette, sub-family A (ABC1), member 1
Description ATP-binding cassette, sub-family A (ABC1), member 1
Chromosome 9q31.1
Also Known As ATP binding cassette transporter 1; ATP-binding cassette 1; ATP-binding cassette transporter A1; ATP-binding cassette, sub-family A member 1; OTTHUMP00000021833; cholesterol efflux regulatory protein; membrane-bound
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21130

ID Symbol Protein Species
GeneID:19 ABCA1 NP_005493.2 Homo sapiens
GeneID:11303 Abca1 NP_038482.3 Mus musculus
GeneID:313210 Abca1 NP_835196.1 Rattus norvegicus
GeneID:373945 ABCA1 NP_989476.1 Gallus gallus
GeneID:464630 ABCA1 XP_001138040.1 Pan troglodytes
GeneID:481651 ABCA1 XP_538773.2 Canis lupus familiaris
GeneID:535379 ABCA1 NP_001019864.1 Bos taurus
GeneID:558924 abca1a XP_687304.3 Danio rerio
GeneID:818768 AT2G41700 NP_850354.2 Arabidopsis thaliana

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab66217 ABCA1 antibody [HJ1] (ab66217); Mouse monoclonal [HJ1] to ABCA1
2 abcam ab14146 ABCA1 antibody (ab14146); Rabbit polyclonal to ABCA1
3 abcam ab7360 ABCA1 antibody (ab7360); Rabbit polyclonal to ABCA1
4 abcam ab18180 ABCA1 antibody [AB.H10] (ab18180); Mouse monoclonal [AB.H10] to ABCA1
5 abnova H00000019-M01A ABCA1 monoclonal antibody (M01), clone 1H4; Mouse monoclonal antibody raised against a partial recombinant ABCA1.
6 scbt ABCA1 ABCA1 Antibody / ABCA1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0045121 Component membrane raft
GO:0045335 Component phagocytic vesicle
GO:0008509 Function anion transmembrane transporter activity
GO:0034188 Function apolipoprotein A-I receptor activity
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0015485 Function cholesterol binding
GO:0017127 Function cholesterol transporter activity
GO:0000166 Function nucleotide binding
GO:0005543 Function phospholipid binding
GO:0005548 Function phospholipid transporter activity
GO:0031267 Function small GTPase binding
GO:0030349 Function syntaxin-13 binding
GO:0032488 Process Cdc42 protein signal transduction
GO:0033344 Process cholesterol efflux
GO:0042632 Process cholesterol homeostasis
GO:0008203 Process cholesterol metabolic process
GO:0016197 Process endosome transport
GO:0010742 Process foam cell differentiation
GO:0007186 Process G-protein coupled receptor protein signaling pathway
GO:0034380 Process high-density lipoprotein particle assembly
GO:0050702 Process interleukin-1 beta secretion
GO:0032367 Process intracellular cholesterol transport
GO:0006629 Process lipid metabolic process
GO:0007040 Process lysosome organization
GO:0033700 Process phospholipid efflux
GO:0055091 Process phospholipid homeostasis
GO:0060155 Process platelet dense granule organization
GO:0030819 Process positive regulation of cAMP biosynthetic process
GO:0010884 Process positive regulation of lipid storage
GO:0043691 Process reverse cholesterol transport
GO:0008202 Process steroid metabolic process
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005502  UCSC Browser NP_005493

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000374736 MI0000266 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENST00000374736 MI0000270 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000374736 MI0000683 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000374736 MI0003139 hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENST00000374736 MI0000077 hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA
ENST00000374736 MI0000740 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENST00000374736 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000374736 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000374736 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000374736 MI0005524 hsa-miR-891a UGCAACGAACCUGAGCCACUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-palmitoyl-2-(5-oxovaleroyl)-sn-glycero-3-phosphorylcholine
  • 1-palmitoyl-2-(5-oxovaleroyl)-sn-glycero-3-phosphorylcholine does not affect the expression of ABCA1 mRNA
16386258
22-hydroxycholesterol
  • 22-hydroxycholesterol results in increased expression of ABCA1 mRNA
16730733, 16142410
25-hydroxycholesterol
  • [25-hydroxycholesterol co-treated with alitretinoin] results in increased expression of ABCA1 protein
16023994
9,11-linoleic acid
  • 9,11-linoleic acid results in increased expression of ABCA1 mRNA
15778275
AGN 193109
  • AGN 193109 inhibits the reaction [Tretinoin results in increased expression of ABCA1 mRNA]
16505366
alitretinoin
  • alitretinoin does not affect the expression of ABCA1 mRNA
16142410
alitretinoin
  • [25-hydroxycholesterol co-treated with alitretinoin] results in increased expression of ABCA1 protein
16023994
Calcitriol
  • Calcitriol results in increased expression of ABCA1 mRNA
16002434
Cholesterol
  • Cholesterol results in increased expression of ABCA1 mRNA
15342687
Cholesterol
  • Cholesterol does not affect the expression of ABCA1 mRNA
  • [Cholesterol co-treated with Dietary Fats] results in increased expression of ABCA1 mRNA
15694933
Cholesterol
  • ABCA1 protein affects the transport of Cholesterol
15883047
Cholesterol
  • ABCA1 protein affects the export of Cholesterol
14993927
Cholesterol, Dietary
  • Cholesterol, Dietary results in increased expression of ABCA1 mRNA
  • [Cholesterol, Dietary co-treated with Cholic Acid] results in increased expression of ABCA1 mRNA
14684380
Cholesterol, HDL
  • ABCA1 gene polymorphism affects the abundance of Cholesterol, HDL
16030523
Cholic Acid
  • Cholic Acid results in increased expression of ABCA1 mRNA
15694933
Cholic Acid
  • [Cholesterol, Dietary co-treated with Cholic Acid] results in increased expression of ABCA1 mRNA
14684380
daidzein
  • [Genistein co-treated with daidzein co-treated with glycitein] results in decreased expression of ABCA1 mRNA
16963248
Dietary Fats
  • [Cholesterol co-treated with Dietary Fats] results in increased expression of ABCA1 mRNA
15694933
Dietary Fats
  • Dietary Fats results in decreased expression of ABCA1 mRNA
18457598
Eicosapentaenoic Acid
  • Eicosapentaenoic Acid results in decreased expression of ABCA1 mRNA
16730733
ezetimibe
  • ezetimibe results in decreased expression of ABCA1 mRNA
16177187
Genistein
  • Genistein results in increased expression of ABCA1 mRNA
18847459
Genistein
  • [Genistein co-treated with daidzein co-treated with glycitein] results in decreased expression of ABCA1 mRNA
16963248
glycitein
  • [Genistein co-treated with daidzein co-treated with glycitein] results in decreased expression of ABCA1 mRNA
16963248
GSK 3987
  • GSK 3987 results in increased expression of ABCA1 mRNA
16107141
GW 3965
  • GW 3965 results in increased expression of ABCA1 mRNA
15633131
GW 3965
  • GW 3965 results in increased expression of ABCA1 mRNA
17449538, 16107141
Lithocholic Acid
  • Lithocholic Acid results in decreased expression of ABCA1 mRNA
  • Lithocholic Acid results in decreased expression of ABCA1 protein
15883047
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ABCA1 mRNA
17681415
Phenytoin
  • Phenytoin results in decreased expression of ABCA1 mRNA
15136057
pirinixic acid
  • pirinixic acid results in increased expression of ABCA1 mRNA
18301758, 17426115
Platelet Activating Factor
  • Platelet Activating Factor does not affect the expression of ABCA1 mRNA
16386258
Pregnenolone Carbonitrile
  • Pregnenolone Carbonitrile results in decreased expression of ABCA1 mRNA
  • Pregnenolone Carbonitrile results in decreased expression of ABCA1 protein
15883047
resveratrol
  • resveratrol results in increased expression of ABCA1 mRNA
16901463
Rifampin
  • Rifampin results in decreased expression of ABCA1 mRNA
  • Rifampin results in decreased expression of ABCA1 protein
15883047
T 0901317
  • T 0901317 results in increased expression of ABCA1 mRNA
17449538, 16142410
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in increased expression of ABCA1 mRNA
15336504
Tetracycline
  • Tetracycline results in increased expression of ABCA1 mRNA
16917069
trans-10,cis-12-conjugated linoleic acid
  • trans-10,cis-12-conjugated linoleic acid results in decreased expression of ABCA1 mRNA
17951470
Tretinoin
  • AGN 193109 inhibits the reaction [Tretinoin results in increased expression of ABCA1 mRNA]
  • Tretinoin results in increased expression of ABCA1 mRNA
16505366

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Coronary Disease marker
Hypercholesterolemia marker
HYPERCHOLESTEROLEMIA, AUTOSOMAL DOMINANT marker
Hyperlipoproteinemia Type II marker 16030523
HYPOALPHALIPOPROTEINEMIA, PRIMARY marker
Tangier Disease marker
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 15748426, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899, 16935935, 12679006
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Mycobacterium Infections inferred via Rifampin 18474467
Tuberculosis inferred via Rifampin 18397238, 15236969
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 16393696, 17534123
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17164350, 17935668, 17049120, 16267019, 16490592
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16456233, 16317513, 17015251, 16525036, 17125593
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 15767336, 17804756, 17718901, 17636462, 16731767
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 16314181, 15827377, 16317513
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Abnormalities, Drug-Induced inferred via Phenytoin 3425630, 10563481
Atherosclerosis inferred via Phenytoin 15136057
Cleft Palate inferred via Phenytoin 2227380, 10789828, 3877104, 1687470, 6856622, 6862529
Congenital Abnormalities inferred via Phenytoin 10627286
Drug Eruptions inferred via Phenytoin 15024534
Epidermolysis Bullosa inferred via Phenytoin 6251365, 1399206
Epilepsies, Partial inferred via Phenytoin 17116037
Epilepsy inferred via Phenytoin 11434505
Fetal Death inferred via Phenytoin 10627286
Gingival Hyperplasia inferred via Phenytoin 9029455
Gingival Overgrowth inferred via Phenytoin 16390469, 14659971
Hyperhomocysteinemia inferred via Phenytoin 10459572
Liver Diseases inferred via Phenytoin 14986274
Myoclonic Epilepsies, Progressive inferred via Phenytoin 17484760
Myotonia Congenita inferred via Phenytoin 1896199
Osteomalacia inferred via Phenytoin 17016548
Pseudolymphoma inferred via Phenytoin 1419762, 8603615, 12752131
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Breast Neoplasms inferred via Genistein 17200150, 16541309, 16873071
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15378649, 15256057
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Cardiovascular Diseases inferred via daidzein 16332659
Diabetes Mellitus, Type 2 inferred via daidzein 16647724
Hypertension inferred via daidzein 17169123
Atherosclerosis inferred via Cholesterol 16632123
Hypercholesterolemia inferred via Cholesterol 16933029
Learning Disorders inferred via Cholesterol 17134702
Niemann-Pick Disease, Type C inferred via Cholesterol 9802331
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16289102, 16644109
Breast Neoplasms inferred via alitretinoin 16344269
Keratosis, Seborrheic inferred via alitretinoin 16144296
Lung Neoplasms inferred via alitretinoin 16413115
Neoplasms inferred via alitretinoin 16946489
Porokeratosis inferred via alitretinoin 16144296
Arteriosclerosis inferred via 9,11-linoleic acid 15778275

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
APOA1 ABCA1 / APOA1 Reconstituted Complex Fitzgerald ML (2002)
APOA1 APOA1 / ABCA1 Reconstituted Complex Fitzgerald ML (2002)
CREBBP ABCA1 / CREBBP Affinity Capture-Western Tini M (2002)
FADD ABCA1 / FADD Reconstituted Complex Buechler C (2002)
FADD FADD / ABCA1 Reconstituted Complex Buechler C (2002)
FADD ABCA1 / FADD Two-hybrid Buechler C (2002)
SNTB2 SNTB2 / ABCA1 Two-hybrid Buechler C (2002)
XPC ABCA1 / XPC Reconstituted Complex Shimizu Y (2003)
XPC ABCA1 / XPC Two-hybrid Shimizu Y (2003)
XPC XPC / ABCA1 Two-hybrid Shimizu Y (2003)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Dagle JM, et al. (2009) "Determination of genetic predisposition to patent ductus arteriosus in preterm infants." Pediatrics. 123(4):1116-1123. PMID:19336370
  2. [ + ] Yoshida T, et al. (2009) "Association of a polymorphism of the apolipoprotein E gene with chronic kidney disease in Japanese individuals with metabolic syndrome." Genomics. 93(3):221-226. PMID:19056482
  3. [ + ] Chen LC, et al. (2009) "[Association of ATP-binding cassette transporter A1 R219K polymorphism with atrial fibrillation]" Nan Fang Yi Ke Da Xue Xue Bao. 29(3):494-496. PMID:19304534
  4. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  5. [ + ] Aulchenko YS, et al. (2009) "Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts." Nat Genet. 41(1):47-55. PMID:19060911
  6. [ + ] Azuma Y, et al. (2009) "Retroendocytosis pathway of ABCA1/apoA-I contributes to HDL formation." Genes Cells. 14(2):191-204. PMID:19170766
  7. [ + ] Karasinska JM, et al. (2009) "Specific loss of brain ABCA1 increases brain cholesterol uptake and influences neuronal structure and function." J Neurosci. 29(11):3579-3589. PMID:19295162
  8. [ + ] Azuma Y, et al. (2009) "The COP9 signalosome controls ubiquitinylation of ABCA1." Biochem Biophys Res Commun. 382(1):145-148. PMID:19268428
  9. [ + ] Deo RC, et al. (2009) "Genetic differences between the determinants of lipid profile phenotypes in African and European Americans: the Jackson Heart Study." PLoS Genet. 5(1):e1000342. PMID:19148283
  10. [ + ] Kathiresan S, et al. (2009) "Common variants at 30 loci contribute to polygenic dyslipidemia." Nat Genet. 41(1):56-65. PMID:19060906
  11. [ + ] Pisciotta L, et al. (2009) "Severe HDL deficiency due to novel defects in the ABCA1 transporter." J Intern Med. 265(3):359-372. PMID:19019193
  12. [ + ] Tsai MY, et al. (2009) "Associations of genetic variants in ATP-binding cassette A1 and cholesteryl ester transfer protein and differences in lipoprotein subclasses in the multi-ethnic study of atherosclerosis." Clin Chem. 55(3):481-488. PMID:19131637
  13. [ + ] Stefulj J, et al. (2009) "Human endothelial cells of the placental barrier efficiently deliver cholesterol to the fetal circulation via ABCA1 and ABCG1." Circ Res. 104(5):600-608. PMID:19168441
  14. [ + ] Kazawa T, et al. (2009) "Expression of liver X receptor alpha and lipid metabolism in granulocyte-macrophage colony-stimulating factor-induced human monocyte-derived macrophage." Pathol Int. 59(3):152-160. PMID:19261092
  15. [ + ] Mauerer R, et al. (2009) "High glucose, unsaturated and saturated fatty acids differentially regulate expression of ATP-binding cassette transporters ABCA1 and ABCG1 in human macrophages." Exp Mol Med. 41(2):126-132. PMID:19287193
  16. [ + ] Ksiazek J, et al. (2009) "Is dyslipidemia sustained during remission of nephrotic syndrome genetically determined? Evaluation of genetic polymorphisms of proteins involved in lipoprotein metabolism in children and adolescents with nephrotic syndrome." Pol Arch Med Wewn. 119(1-2):11-16. PMID:19341173
  17. [ + ] Porchay-Balderelli I, et al. (2009) "Relationships between common polymorphisms of adenosine triphosphate-binding cassette transporter A1 and high-density lipoprotein cholesterol and coronary heart disease in a population with type 2 diabetes mellitus." Metabolism. 58(1):74-79. PMID:19059534
  18. [ + ] Vaughan AM, et al. (2009) "ABCA1 mutants reveal an interdependency between lipid export function, apoA-I binding activity, and Janus kinase 2 activation." J Lipid Res. 50(2):285-292. PMID:18776170
  19. [ + ] Linder MD, et al. (2009) "Rab8 regulates ABCA1 cell surface expression and facilitates cholesterol efflux in primary human macrophages." Arterioscler Thromb Vasc Biol. 29(6):883-888. PMID:19304576
  20. [ + ] Lopez-Simon L, et al. (2009) "Genetic determinants of plasma HDL-cholesterol levels in prepubertal children." Clin Chim Acta. 403(1-2):203-206. PMID:19285487
  21. [ + ] Hozoji M, et al. (2009) "Formation of two intramolecular disulfide bonds is necessary for ApoA-I-dependent cholesterol efflux mediated by ABCA1." J Biol Chem. 284(17):11293-11300. PMID:19258317
  22. [ + ] Brunham LR, et al. (2009) "Tissue-specific roles of ABCA1 influence susceptibility to atherosclerosis." Arterioscler Thromb Vasc Biol. 29(4):548-554. PMID:19201688
  23. [ + ] Schippling S, et al. (2008) "Severe Tangier disease with a novel ABCA1 gene mutation." Neurology. 71(18):1454-1455. PMID:18955690
  24. [ + ] Isomura M, et al. (2008) "IL12RB2 and ABCA1 genes are associated with susceptibility to radiation dermatitis." Clin Cancer Res. 14(20):6683-6689. PMID:18927311
  25. [ + ] Willer CJ, et al. (2008) "Newly identified loci that influence lipid concentrations and risk of coronary artery disease." Nat Genet. 40(2):161-169. PMID:18193043
  26. [ + ] Catakoglu AB, et al. (2008) "Common variants in the ATP-binding cassette transporter 1 gene with decreased HDL-cholesterol levels and coronary artery disease." Arch Med Res. 39(8):735-742. PMID:18996286
  27. [ + ] Corsetti JP, et al. (2008) "Lp(a) and Risk of Recurrent Cardiac Events in Obese Postinfarction Patients." Obesity (Silver Spring). ():. PMID:18927546
  28. [ + ] Yamada Y, et al. (2008) "Association of polymorphisms of ABCA1 and ROS1 with hypertension in Japanese individuals." Int J Mol Med. 21(1):83-89. PMID:18097620
  29. [ + ] Catalano G, et al. (2008) "Cellular SR-BI and ABCA1-mediated cholesterol efflux are gender-specific in healthy subjects." J Lipid Res. 49(3):635-643. PMID:18057374
  30. [ + ] Delvecchio CJ, et al. (2008) "LXR-induced reverse cholesterol transport in human airway smooth muscle is mediated exclusively by ABCA1." Am J Physiol Lung Cell Mol Physiol. 295(5):L949-L957. PMID:18820007
  31. [ + ] Sandhofer A, et al. (2008) "The influence of two variants in the adenosine triphosphate-binding cassette transporter 1 gene on plasma lipids and carotid atherosclerosis." Metabolism. 57(10):1398-1404. PMID:18803945
  32. [ + ] Villarreal-Molina MT, et al. (2008) "Association of the ATP-binding cassette transporter A1 R230C variant with early-onset type 2 diabetes in a Mexican population." Diabetes. 57(2):509-513. PMID:18003760
  33. [ + ] Kathiresan S, et al. (2008) "Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans." Nat Genet. 40(2):189-197. PMID:18193044
  34. [ + ] Sethi AA, et al. (2008) "Asymmetry in the lipid affinity of bihelical amphipathic peptides. A structural determinant for the specificity of ABCA1-dependent cholesterol efflux by peptides." J Biol Chem. 283(47):32273-32282. PMID:18805791
  35. [ + ] Xue XH, et al. (2008) "Novel mutation in the ABCA1 gene identified in a chinese patient with dementia and atherothrombotic cerebral infarction." Dement Geriatr Cogn Disord. 26(3):234-238. PMID:18841006
  36. [ + ] Kypreos KE, et al. (2008) "ABCA1 promotes the de novo biogenesis of apolipoprotein CIII-containing HDL particles in vivo and modulates the severity of apolipoprotein CIII-induced hypertriglyceridemia." Biochemistry. 47(39):10491-10502. PMID:18767813
  37. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  38. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  39. [ + ] Iatan I, et al. (2008) "Effect of ABCA1 mutations on risk for myocardial infarction." Curr Atheroscler Rep. 10(5):413-426. PMID:18706283
  40. [ + ] Lu R, et al. (2008) "ApoA-I facilitates ABCA1 recycle/accumulation to cell surface by inhibiting its intracellular degradation and increases HDL generation." Arterioscler Thromb Vasc Biol. 28(10):1820-1824. PMID:18617649
  41. [ + ] Field FJ, et al. (2008) "Origins of intestinal ABCA1-mediated HDL-cholesterol." J Lipid Res. 49(12):2605-2619. PMID:18711208
  42. [ + ] Tazoe F, et al. (2008) "Induction of ABCA1 by overexpression of hormone-sensitive lipase in macrophages." Biochem Biophys Res Commun. 376(1):111-115. PMID:18762171
  43. [ + ] Mulya A, et al. (2008) "Initial interaction of apoA-I with ABCA1 impacts in vivo metabolic fate of nascent HDL." J Lipid Res. 49(11):2390-2401. PMID:18583707
  44. [ + ] Genvigir FD, et al. (2008) "Effects of ABCA1 SNPs, including the C-105T novel variant, on serum lipids of Brazilian individuals." Clin Chim Acta. 389(1-2):79-86. PMID:18164264
  45. [ + ] Wang N, et al. (2008) "The R219K polymorphism in the ATP-binding cassette transporter 1 gene has a protective effect on atherothrombotic cerebral infarction in Chinese Han ethnic population." Neurobiol Aging. ():. PMID:18621447
  46. [ + ] Frikke-Schmidt R, et al. (2008) "Association of loss-of-function mutations in the ABCA1 gene with high-density lipoprotein cholesterol levels and risk of ischemic heart disease." JAMA. 299(21):2524-2532. PMID:18523221