abf-4 | GeneID:189702 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 189702 Official Symbol abf-4
Locus Y38H6C.22 Gene Type protein-coding
Synonyms
Full Name N/A
Description AntiBacterial Factor related
Chromosome N/A
Also Known As AntiBacterial Factor related family member (abf-4)
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_075564 NP_507965

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
Y38H6C.22 MI0000005 cel-miR-34 AGGCAGUGUGGUUAGCUGGUUG
Y38H6C.22 MI0000047 cel-miR-76 UUCGUUGUUGAUGAAGCCUUGA
Y38H6C.22 MI0000058 cel-miR-87 GUGAGCAAAGUUUCAGGUGUGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_075564  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene