7tm_1 | GeneID:186764 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 186764 Official Symbol 7tm_1
Locus H23L24.4 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_069094 NP_501495

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
H23L24.4 MI0000051 cel-miR-227 AGCUUUCGACAUGAUUCUGAAC
H23L24.4 MI0000304 cel-miR-229 AAUGACACUGGUUAUCUUUUCCAUCG
H23L24.4 MI0000819 cel-miR-392 UAUCAUCGAUCACGUGUGAUGA
H23L24.4 MI0000034 cel-miR-63 UAUGACACUGAAGCGAGUUGGAAA
H23L24.4 MI0000035 cel-miR-64 UAUGACACUGAAGCGUUACCGAA
H23L24.4 MI0000036 cel-miR-65 UAUGACACUGAAGCGUAACCGAA
H23L24.4 MI0000037 cel-miR-66 CAUGACACUGAUUAGGGAUGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_069094  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene