abf-3 | GeneID:186202 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 186202 Official Symbol abf-3
Locus F54B8.5 Gene Type protein-coding
Synonyms
Full Name N/A
Description AntiBacterial Factor related
Chromosome N/A
Also Known As AntiBacterial Factor related family member (abf-3)
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_074549 NP_506950

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F54B8.5 MI0000311 cel-miR-236 UAAUACUGUCAGGUAAUGACGCU
F54B8.5 MI0005186 cel-miR-786 UAAUGCCCUGAAUGAUGUUCAAU
F54B8.5 MI0005199 cel-miR-798 UAAGCCUUACAUAUUGACUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_074549  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene