abts-2 | GeneID:186108 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 186108 Official Symbol abts-2
Locus F52D10.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description Anion/Bicarbonate TranSporter family
Chromosome N/A
Also Known As Anion/Bicarbonate TranSporter family member (abts-2)
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0015380 Function anion exchanger activity
GO:0005452 Function inorganic anion exchanger activity
GO:0006820 Process anion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_077535 NP_509936

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F52D10.1 MI0000032 cel-miR-61 UGACUAGAACCGUUACUCAUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_077535  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
K09G1.1 abts-2 / K09G1.1 Two-hybrid Li S (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431
  2. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  3. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719