abu-10 | GeneID:185248 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 185248 Official Symbol abu-10
Locus F35A5.3 Gene Type protein-coding
Synonyms
Full Name N/A
Description Activated in Blocked Unfolded protein response
Chromosome N/A
Also Known As Activated in Blocked Unfolded protein response family member (abu-10)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 114070

ID Symbol Protein Species
GeneID:173404 abu-11 NP_493679.1 Caenorhabditis elegans
GeneID:174337 M195.2 NP_495760.2 Caenorhabditis elegans
GeneID:174407 F07H5.8 NP_495874.1 Caenorhabditis elegans
GeneID:174464 pqn-95 NP_495966.2 Caenorhabditis elegans
GeneID:174597 M02G9.1 NP_496223.2 Caenorhabditis elegans
GeneID:178903 abu-6 NP_504383.1 Caenorhabditis elegans
GeneID:178904 abu-8 NP_504393.1 Caenorhabditis elegans
GeneID:178954 pqn-13 NP_504494.2 Caenorhabditis elegans
GeneID:181800 abu-1 NP_505667.1 Caenorhabditis elegans
GeneID:181801 pqn-2 NP_505668.2 Caenorhabditis elegans
GeneID:182136 pqn-5 NP_504382.1 Caenorhabditis elegans
GeneID:182139 abu-7 NP_504384.1 Caenorhabditis elegans
GeneID:182836 pqn-16 NP_505378.1 Caenorhabditis elegans
GeneID:184695 abu-2 NP_508265.1 Caenorhabditis elegans
GeneID:185133 abu-3 NP_510839.1 Caenorhabditis elegans
GeneID:185248 abu-10 NP_508659.1 Caenorhabditis elegans
GeneID:185249 F35A5.4 NP_508657.2 Caenorhabditis elegans
GeneID:187405 M02G9.2 NP_496222.2 Caenorhabditis elegans
GeneID:187406 M02G9.3 NP_496221.1 Caenorhabditis elegans
GeneID:187728 pqn-54 NP_503423.1 Caenorhabditis elegans
GeneID:187749 abu-9 NP_509407.1 Caenorhabditis elegans
GeneID:187751 pqn-57 NP_509406.1 Caenorhabditis elegans
GeneID:188802 pqn-71 NP_506849.1 Caenorhabditis elegans
GeneID:190671 pqn-90 NP_502843.1 Caenorhabditis elegans
GeneID:190672 pqn-91 NP_502844.1 Caenorhabditis elegans
GeneID:190869 pqn-76 NP_502872.1 Caenorhabditis elegans
GeneID:190870 abu-5 NP_502873.1 Caenorhabditis elegans
GeneID:190871 pqn-78 NP_502874.1 Caenorhabditis elegans
GeneID:190872 pqn-79 NP_502875.1 Caenorhabditis elegans
GeneID:353458 abu-4 NP_872210.1 Caenorhabditis elegans
GeneID:3896863 Y5H2A.4 NP_001033518.1 Caenorhabditis elegans

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005515 Function protein binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_076258 NP_508659

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F35A5.3 MI0000003 cel-miR-1 UGGAAUGUAAAGAAGUAUGUA
F35A5.3 MI0000042 cel-miR-71 UGAAAGACAUGGGUAGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_076258  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
fibrulin-1D abu-10 / fibrulin-1D Two-hybrid Li S (2004)
N/A abu-10 / N/A Two-hybrid Li S (2004)
ppn-1 abu-10 / ppn-1 Two-hybrid Li S (2004)
pqn-95 abu-10 / pqn-95 Two-hybrid Li S (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431