abu-3 | GeneID:185133 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 185133 Official Symbol abu-3
Locus F31A3.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description Activated in Blocked Unfolded protein response
Chromosome N/A
Also Known As Activated in Blocked Unfolded protein response family member (abu-3)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 114070

ID Symbol Protein Species
GeneID:173404 abu-11 NP_493679.1 Caenorhabditis elegans
GeneID:174337 M195.2 NP_495760.2 Caenorhabditis elegans
GeneID:174407 F07H5.8 NP_495874.1 Caenorhabditis elegans
GeneID:174464 pqn-95 NP_495966.2 Caenorhabditis elegans
GeneID:174597 M02G9.1 NP_496223.2 Caenorhabditis elegans
GeneID:178903 abu-6 NP_504383.1 Caenorhabditis elegans
GeneID:178904 abu-8 NP_504393.1 Caenorhabditis elegans
GeneID:178954 pqn-13 NP_504494.2 Caenorhabditis elegans
GeneID:181800 abu-1 NP_505667.1 Caenorhabditis elegans
GeneID:181801 pqn-2 NP_505668.2 Caenorhabditis elegans
GeneID:182136 pqn-5 NP_504382.1 Caenorhabditis elegans
GeneID:182139 abu-7 NP_504384.1 Caenorhabditis elegans
GeneID:182836 pqn-16 NP_505378.1 Caenorhabditis elegans
GeneID:184695 abu-2 NP_508265.1 Caenorhabditis elegans
GeneID:185133 abu-3 NP_510839.1 Caenorhabditis elegans
GeneID:185248 abu-10 NP_508659.1 Caenorhabditis elegans
GeneID:185249 F35A5.4 NP_508657.2 Caenorhabditis elegans
GeneID:187405 M02G9.2 NP_496222.2 Caenorhabditis elegans
GeneID:187406 M02G9.3 NP_496221.1 Caenorhabditis elegans
GeneID:187728 pqn-54 NP_503423.1 Caenorhabditis elegans
GeneID:187749 abu-9 NP_509407.1 Caenorhabditis elegans
GeneID:187751 pqn-57 NP_509406.1 Caenorhabditis elegans
GeneID:188802 pqn-71 NP_506849.1 Caenorhabditis elegans
GeneID:190671 pqn-90 NP_502843.1 Caenorhabditis elegans
GeneID:190672 pqn-91 NP_502844.1 Caenorhabditis elegans
GeneID:190869 pqn-76 NP_502872.1 Caenorhabditis elegans
GeneID:190870 abu-5 NP_502873.1 Caenorhabditis elegans
GeneID:190871 pqn-78 NP_502874.1 Caenorhabditis elegans
GeneID:190872 pqn-79 NP_502875.1 Caenorhabditis elegans
GeneID:353458 abu-4 NP_872210.1 Caenorhabditis elegans
GeneID:3896863 Y5H2A.4 NP_001033518.1 Caenorhabditis elegans

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_078438 NP_510839

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F31A3.1 MI0000331 cel-miR-255 AAACUGAAGAGAUUUUUUACAG
F31A3.1 MI0000334 cel-miR-257 GAGUAUCAGGAGUACCCAGUGA
F31A3.1 MI0000338 cel-miR-261 UAGCUUUUUAGUUUUCACG
F31A3.1 MI0000022 cel-miR-51 UACCCGUAGCUCCUAUCCAUGUU
F31A3.1 MI0000023 cel-miR-52 CACCCGUACAUAUGUUUCCGUGCU
F31A3.1 MI0000024 cel-miR-53 CACCCGUACAUUUGUUUCCGUGCU
F31A3.1 MI0000025 cel-miR-54 UACCCGUAAUCUUCAUAAUCCGAG
F31A3.1 MI0000026 cel-miR-55 UACCCGUAUAAGUUUCUGCUGAG
F31A3.1 MI0000027 cel-miR-56 UACCCGUAAUGUUUCCGCUGAG
F31A3.1 MI0005186 cel-miR-786 UAAUGCCCUGAAUGAUGUUCAAU
F31A3.1 MI0005191 cel-miR-790 CUUGGCACUCGCGAACACCGCG
F31A3.1 MI0005192 cel-miR-791 UUUGGCACUCCGCAGAUAAGGCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_078438  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Atrazine
  • Atrazine results in decreased expression of ABU-3 mRNA
16168746
resveratrol
  • resveratrol results in increased expression of ABU-3 mRNA
16256736

Transcript Cluster

[ - ] NCBI's UniGene