aat-2 | GeneID:184126 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 184126 Official Symbol aat-2
Locus F07C3.7 Gene Type protein-coding
Synonyms
Full Name N/A
Description Amino Acid Transporter
Chromosome N/A
Also Known As Amino Acid Transporter family member (aat-2)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 88701

ID Symbol Protein Species
GeneID:9056 SLC7A7 NP_003973.2 Homo sapiens
GeneID:20540 Slc7a7 NP_035535.2 Mus musculus
GeneID:39625 mnd NP_730006.1 Drosophila melanogaster
GeneID:83509 Slc7a7 NP_112631.1 Rattus norvegicus
GeneID:184126 aat-2 NP_505394.2 Caenorhabditis elegans
GeneID:420216 SLC7A7 XP_418326.2 Gallus gallus
GeneID:452786 SLC7A7 XP_509841.2 Pan troglodytes
GeneID:490602 SLC7A7 XP_547724.2 Canis lupus familiaris
GeneID:504220 SLC7A7 NP_001068619.1 Bos taurus
GeneID:641560 slc7a7 NP_001032648.1 Danio rerio
GeneID:1278313 AgaP_AGAP011386 XP_317936.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0015171 Function amino acid transmembrane transporter activity
GO:0006865 Process amino acid transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_072993 NP_505394

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F07C3.7 MI0000021 cel-miR-50 UGAUAUGUCUGGUAUUCUUGGG
F07C3.7 MI0000033 cel-miR-62 UGAUAUGUAAUCUAGCUUACAG
F07C3.7 MI0000036 cel-miR-65 UAUGACACUGAAGCGUAACCGAA
F07C3.7 MI0005194 cel-miR-793 UGAGGUAUCUUAGUUAGACAGA
F07C3.7 MI0000059 cel-miR-90 UGAUAUGUUGUUUGAAUGCCCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_072993  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719