abcx-1 | GeneID:183860 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 183860 Official Symbol abcx-1
Locus C56E6.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description ABC transporter, eXtended
Chromosome N/A
Also Known As ABC transporter, eXtended family member (abcx-1)
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0009792 Process embryonic development ending in birth or egg hatching
GO:0040007 Process growth
GO:0002119 Process nematode larval development

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_062920 NP_495321

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C56E6.1 MI0000303 cel-miR-228 AAUGGCACUGCAUGAAUUCACGG
C56E6.1 MI0000304 cel-miR-229 AAUGACACUGGUUAUCUUUUCCAUCG
C56E6.1 MI0000034 cel-miR-63 UAUGACACUGAAGCGAGUUGGAAA
C56E6.1 MI0000035 cel-miR-64 UAUGACACUGAAGCGUUACCGAA
C56E6.1 MI0000036 cel-miR-65 UAUGACACUGAAGCGUAACCGAA
C56E6.1 MI0000037 cel-miR-66 CAUGACACUGAUUAGGGAUGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_062920  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sonnichsen B, et al. (2005) "Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans." Nature. 434(7032):462-469. PMID:15791247
  2. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  3. [ + ] Kamath RS, et al. (2003) "Systematic functional analysis of the Caenorhabditis elegans genome using RNAi." Nature. 421(6920):231-237. PMID:12529635
  4. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719
  5. [ + ] Simmer F, et al. (2003) "Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions." PLoS Biol. 1(1):E12. PMID:14551910