acc-2 | GeneID:183758 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 183758 Official Symbol acc-2
Locus C53D6.3 Gene Type protein-coding
Synonyms
Full Name N/A
Description Acetylcholine-gated Chloride Channel
Chromosome N/A
Also Known As Acetylcholine-gated Chloride Channel family member (acc-2)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 119144

ID Symbol Protein Species
GeneID:175279 lgc-46 NP_497338.2 Caenorhabditis elegans
GeneID:176778 acc-4 NP_499789.1 Caenorhabditis elegans
GeneID:177799 acc-1 NP_501715.1 Caenorhabditis elegans
GeneID:179269 mod-1 NP_741580.1 Caenorhabditis elegans
GeneID:179547 lgc-49 NP_505841.2 Caenorhabditis elegans
GeneID:180312 lgc-55 NP_507870.2 Caenorhabditis elegans
GeneID:181193 lgc-47 NP_741878.1 Caenorhabditis elegans
GeneID:183638 lgc-48 NP_506308.2 Caenorhabditis elegans
GeneID:183758 acc-2 NP_501567.1 Caenorhabditis elegans
GeneID:184377 lgc-51 NP_490946.3 Caenorhabditis elegans
GeneID:186307 acc-3 NP_508810.2 Caenorhabditis elegans
GeneID:188525 lgc-54 NP_504741.2 Caenorhabditis elegans
GeneID:188633 lgc-50 NP_498637.2 Caenorhabditis elegans
GeneID:188702 lgc-53 NP_741945.3 Caenorhabditis elegans
GeneID:190669 lgc-52 NP_502839.2 Caenorhabditis elegans
GeneID:191638 ggr-3 NP_494951.2 Caenorhabditis elegans

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0045211 Component postsynaptic membrane
GO:0005230 Function extracellular ligand-gated ion channel activity
GO:0004890 Function GABA-A receptor activity
GO:0030594 Function neurotransmitter receptor activity
GO:0006811 Process ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_069166 NP_501567

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C53D6.3 MI0000002 cel-lin-4 UCCCUGAGACCUCAAGUGUGA
C53D6.3 MI0000312 cel-miR-237 UCCCUGAGAAUUCUCGAACAGCU
C53D6.3 MI0000329 cel-miR-253* CACACCUCACUAACACUGACC
C53D6.3 MI0000020 cel-miR-49 AAGCACCACGAGAAGCUGCAGA
C53D6.3 MI0005188 cel-miR-788 UCCGCUUCUAACUUCCAUUUGCAG
C53D6.3 MI0005193 cel-miR-792 UUGAAAUCUCUUCAACUUUCAGA
C53D6.3 MI0000054 cel-miR-83 UAGCACCAUAUAAAUUCAGUAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_069166  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719