AC7.3 | GeneID:181802 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 181802 Official Symbol AC7.3
Locus AC7.3 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_068323 NP_500724

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
AC7.3 MI0000002 cel-lin-4 UCCCUGAGACCUCAAGUGUGA
AC7.3 MI0000757 cel-miR-358 AUUGGUAUCCCUGUCAAGGUC
AC7.3 MI0000034 cel-miR-63 UAUGACACUGAAGCGAGUUGGAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_068323  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene