6R55.2 | GeneID:181798 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 181798 Official Symbol 6R55.2
Locus 6R55.2 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_078462 NP_510863

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
6R55.2 MI0000318 cel-miR-242 UUGCGUAGGCCUUUGCUUCGA
6R55.2 MI0000329 cel-miR-253* CACACCUCACUAACACUGACC
6R55.2 MI0000006 cel-miR-35 UCACCGGGUGGAAACUAGCAGU
6R55.2 MI0000007 cel-miR-36 UCACCGGGUGAAAAUUCGCAUG
6R55.2 MI0000759 cel-miR-360 UGACCGUAAUCCCGUUCACAA
6R55.2 MI0000008 cel-miR-37 UCACCGGGUGAACACUUGCAGU
6R55.2 MI0000012 cel-miR-41 UCACCGGGUGAAAAAUCACCUA
6R55.2 MI0000013 cel-miR-42 UCACCGGGUUAACAUCUACAGA
6R55.2 MI0000024 cel-miR-53 CACCCGUACAUUUGUUUCCGUGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_078462  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene