4R79.2 | GeneID:181797 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 181797 Official Symbol 4R79.2
Locus 4R79.2 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 119480

ID Symbol Protein Species
GeneID:181797 4R79.2 NP_503120.1 Caenorhabditis elegans
GeneID:771371 LOC771371 XP_001234654.1 Gallus gallus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005622 Component intracellular
GO:0003924 Function GTPase activity
GO:0005525 Function GTP binding
GO:0005515 Function protein binding
GO:0006886 Process intracellular protein transport
GO:0006913 Process nucleocytoplasmic transport
GO:0015031 Process protein transport
GO:0007165 Process signal transduction
GO:0007264 Process small GTPase mediated signal transduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_070719 NP_503120

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
4R79.2 MI0000303 cel-miR-228 AAUGGCACUGCAUGAAUUCACGG
4R79.2 MI0000307 cel-miR-232 UAAAUGCAUCUUAACUGCGGUGA
4R79.2 MI0000335 cel-miR-258 GGUUUUGAGAGGAAUCCUUUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_070719  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719