2L52.1 | GeneID:181792 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 181792 Official Symbol 2L52.1
Locus 2L52.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_061228 NP_493629

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
2L52.1 MI0000334 cel-miR-257 GAGUAUCAGGAGUACCCAGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_061228  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene