acdh-7 | GeneID:181758 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 181758 Official Symbol acdh-7
Locus T25G12.5 Gene Type protein-coding
Synonyms
Full Name N/A
Description Acyl CoA DeHydrogenase
Chromosome N/A
Also Known As Acyl CoA DeHydrogenase family member (acdh-7)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3

ID Symbol Protein Species
GeneID:34 ACADM NP_000007.1 Homo sapiens
GeneID:11364 Acadm NP_031408.1 Mus musculus
GeneID:24158 Acadm NP_058682.1 Rattus norvegicus
GeneID:38864 CG12262 NP_648149.1 Drosophila melanogaster
GeneID:173979 K05F1.3 NP_495142.1 Caenorhabditis elegans
GeneID:181757 T08G2.3 NP_510788.1 Caenorhabditis elegans
GeneID:181758 T25G12.5 NP_510789.1 Caenorhabditis elegans
GeneID:406283 acadm NP_998175.1 Danio rerio
GeneID:469356 ACADM XP_524741.2 Pan troglodytes
GeneID:490207 ACADM XP_547328.2 Canis lupus familiaris
GeneID:505968 ACADM NP_001068703.1 Bos taurus
GeneID:1276346 AgaP_AGAP005662 XP_315683.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0016491 Function oxidoreductase activity
GO:0016627 Function oxidoreductase activity, acting on the CH-CH group of donors
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_078388 NP_510789

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
T25G12.5.1 MI0000330 cel-miR-254 UGCAAAUCUUUCGCGACUGUAGG
T25G12.5.1 MI0000349 cel-miR-269 GGCAAGACUCUGGCAAAACU
T25G12.5.1 MI0000030 cel-miR-59 UCGAAUCGUUUAUCAGGAUGAUG
T25G12.5.2 MI0000312 cel-miR-237 UCCCUGAGAAUUCUCGAACAGCU
T25G12.5.2 MI0000330 cel-miR-254 UGCAAAUCUUUCGCGACUGUAGG
T25G12.5.2 MI0000347 cel-miR-267 CCCGUGAAGUGUCUGCUGCA
T25G12.5.2 MI0000349 cel-miR-269 GGCAAGACUCUGGCAAAACU
T25G12.5.2 MI0000030 cel-miR-59 UCGAAUCGUUUAUCAGGAUGAUG
T25G12.5.2 MI0005186 cel-miR-786 UAAUGCCCUGAAUGAUGUUCAAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_078388  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431
  2. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  3. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719