aakb-1 | GeneID:181492 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 181492 Official Symbol aakb-1
Locus F55F3.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description AMP-Activated Kinase Beta subunit
Chromosome N/A
Also Known As AMP-Activated Kinase Beta subunit family member (aakb-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 38046

ID Symbol Protein Species
GeneID:5565 PRKAB2 NP_005390.1 Homo sapiens
GeneID:64562 Prkab2 NP_072149.1 Rattus norvegicus
GeneID:108097 Prkab2 NP_892042.2 Mus musculus
GeneID:176552 aakb-2 NP_499446.1 Caenorhabditis elegans
GeneID:181492 aakb-1 NP_510298.1 Caenorhabditis elegans
GeneID:427017 PRKAB2 NP_001038127.1 Gallus gallus
GeneID:457245 PRKAB2 XP_513749.2 Pan troglodytes
GeneID:512665 PRKAB2 XP_590219.2 Bos taurus
GeneID:612807 PRKAB2 XP_850153.1 Canis lupus familiaris
GeneID:827331 AT4G16360 NP_193369.1 Arabidopsis thaliana
GeneID:856749 GAL83 NP_010944.1 Saccharomyces cerevisiae
GeneID:2897233 KLLA0B00583g XP_451556.1 Kluyveromyces lactis
GeneID:4621433 AGOS_AER361C NP_985217.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_077897 NP_510298

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F55F3.1.1 MI0000335 cel-miR-258 GGUUUUGAGAGGAAUCCUUUU
F55F3.1.1 MI0000348 cel-miR-268 GGCAAGAAUUAGAAGCAGUUUGGU
F55F3.1.2 MI0000335 cel-miR-258 GGUUUUGAGAGGAAUCCUUUU
F55F3.1.2 MI0000348 cel-miR-268 GGCAAGAAUUAGAAGCAGUUUGGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_077897  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene