Npm1 | GeneID:18148 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 18148 Official Symbol Npm1
Locus RP23-323L8.2 Gene Type protein-coding
Synonyms B23; MGC102162; MGC107291; NO38; Npm
Full Name nucleophosmin 1
Description nucleophosmin 1
Chromosome 11 A4
Also Known As OTTMUSP00000005572; nucleolar protein NO38
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 81697

ID Symbol Protein Species
GeneID:18148 Npm1 NP_032748.1 Mus musculus
GeneID:25498 Npm1 NP_037124.1 Rattus norvegicus
GeneID:266985 npm1 NP_955460.1 Danio rerio
GeneID:396203 NPM1 NP_990598.1 Gallus gallus
GeneID:475722 LOC475722 XP_863138.1 Canis lupus familiaris
GeneID:608196 LOC608196 XP_849946.1 Canis lupus familiaris
GeneID:614028 NPM1 NP_001030518.1 Bos taurus
GeneID:740704 LOC740704 XP_001142859.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab15440 Nucleophosmin antibody (ab15440); Rabbit polyclonal to Nucleophosmin
2 abcam ab10530 Nucleophosmin antibody [FC82291] (ab10530); Mouse monoclonal [FC82291] to Nucleophosmin
3 abcam ab69981 Nucleophosmin antibody (ab69981); Rabbit polyclonal to Nucleophosmin
4 abcam ab63622 Nucleophosmin antibody (ab63622); Rabbit polyclonal to Nucleophosmin
5 abcam ab59353 Nucleophosmin (phospho T199) antibody (ab59353); Rabbit polyclonal to Nucleophosmin (phospho T199)
6 abcam ab37659 Nucleophosmin antibody (ab37659); Rabbit polyclonal to Nucleophosmin
7 abcam ab31319 Nucleophosmin antibody (ab31319); Goat polyclonal to Nucleophosmin
8 sigma B0556 Monoclonal Anti-B23 antibody produced in mouse ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005813 Component centrosome
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0001652 Component granular component
GO:0015934 Component large ribosomal subunit
GO:0016607 Component nuclear speck
GO:0005730 Component nucleolus
GO:0005654 Component nucleoplasm
GO:0005634 Component nucleus
GO:0030529 Component ribonucleoprotein complex
GO:0015935 Component small ribosomal subunit
GO:0003677 Function DNA binding
GO:0003676 Function nucleic acid binding
GO:0005515 Function protein binding
GO:0043023 Function ribosomal large subunit binding
GO:0043024 Function ribosomal small subunit binding
GO:0003723 Function RNA binding
GO:0019843 Function rRNA binding
GO:0016049 Process cell growth
GO:0006884 Process cell volume homeostasis
GO:0048025 Process negative regulation of nuclear mRNA splicing, via spliceosome
GO:0006913 Process nucleocytoplasmic transport
GO:0008284 Process positive regulation of cell proliferation
GO:0031328 Process positive regulation of cellular biosynthetic process
GO:0010825 Process positive regulation of centrosome duplication
GO:0045860 Process positive regulation of protein kinase activity
GO:0008104 Process protein localization
GO:0051259 Process protein oligomerization
GO:0051726 Process regulation of cell cycle
GO:0010824 Process regulation of centrosome duplication
GO:0043516 Process regulation of DNA damage response, signal transduction by p53 class mediator
GO:0042273 Process ribosomal large subunit biogenesis
GO:0000055 Process ribosomal large subunit export from nucleus
GO:0042274 Process ribosomal small subunit biogenesis
GO:0000056 Process ribosomal small subunit export from nucleus
GO:0006407 Process rRNA export from nucleus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_008722  UCSC Browser NP_032748 Q5SQB7   Q61937  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000075641 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSMUST00000075641 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSMUST00000075641 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSMUST00000075641 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSMUST00000075641 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSMUST00000075641 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENSMUST00000075641 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENSMUST00000075641 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSMUST00000075641 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSMUST00000075641 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENSMUST00000075641 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSMUST00000075641 MI0000153 mmu-miR-126-5p CAUUAUUACUUUUGGUACGCG
ENSMUST00000075641 MI0000257 mmu-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSMUST00000075641 MI0000170 mmu-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENSMUST00000075641 MI0004665 mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU
ENSMUST00000075641 MI0000550 mmu-miR-148a* AAAGUUCUGAGACACUCCGACU
ENSMUST00000075641 MI0000224 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG
ENSMUST00000075641 MI0000710 mmu-miR-222 AGCUACAUCUGGCUACUGGGU
ENSMUST00000075641 MI0000142 mmu-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSMUST00000075641 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSMUST00000075641 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSMUST00000075641 MI0000391 mmu-miR-293* ACUCAAACUGUGUGACAUUUUG
ENSMUST00000075641 MI0005488 mmu-miR-297a* UAUACAUACACACAUACCCAUA
ENSMUST00000075641 MI0005489 mmu-miR-297a* UAUACAUACACACAUACCCAUA
ENSMUST00000075641 MI0000597 mmu-miR-325 UUUAUUGAGCACCUCCUAUCAA
ENSMUST00000075641 MI0000761 mmu-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSMUST00000075641 MI0000763 mmu-miR-362-5p AAUCCUUGGAACCUAGGUGUGAAU
ENSMUST00000075641 MI0001730 mmu-miR-451 AAACCGUUACCAUUACUGAGUU
ENSMUST00000075641 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSMUST00000075641 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSMUST00000075641 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSMUST00000075641 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSMUST00000075641 MI0002402 mmu-miR-467a* AUAUACAUACACACACCUACAC
ENSMUST00000075641 MI0004671 mmu-miR-467b* AUAUACAUACACACACCAACAC
ENSMUST00000075641 MI0006128 mmu-miR-467e* AUAUACAUACACACACCUAUAU
ENSMUST00000075641 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSMUST00000075641 MI0004633 mmu-miR-488* CCCAGAUAAUAGCACUCUCAA
ENSMUST00000075641 MI0005002 mmu-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSMUST00000075641 MI0004680 mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG
ENSMUST00000075641 MI0003519 mmu-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSMUST00000075641 MI0005549 mmu-miR-872* UGAACUAUUGCAGUAGCCUCCU
ENSMUST00000075641 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENSMUST00000075641 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAA39801   AAH54755   AAH85278   AAH89546   AAH90843   AAH92378   BAB24014   BAC25844   BAC25910   BAC40655   BAE22562   BAE26248   BAE26667   BAE29354   BAE32244   BAE38420   CAI25148   CAI25149   CAI25150   CAI25151   EDL23744   NP_032748   Q3U536   Q3UDA7   Q5BL09   Q5SQB0   Q5SQB5   Q5SQB7   Q5U438   Q61937   Q8BSZ3   Q9DAY9  

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Apicelli AJ, et al. (2008) "A non-tumor suppressor role for basal p19ARF in maintaining nucleolar structure and function." Mol Cell Biol. 28(3):1068-1080. PMID:18070929
  2. [ + ] Parlato R, et al. (2008) "Activation of an endogenous suicide response after perturbation of rRNA synthesis leads to neurodegeneration in mice." J Neurosci. 28(48):12759-12764. PMID:19036968
  3. [ + ] Li Z, et al. (2008) "Nucleophosmin interacts directly with c-Myc and controls c-Myc-induced hyperproliferation and transformation." Proc Natl Acad Sci U S A. 105(48):18794-18799. PMID:19033198
  4. [ + ] Kuo ML, et al. (2008) "Arf-induced turnover of the nucleolar nucleophosmin-associated SUMO-2/3 protease Senp3." Cell Cycle. 7(21):3378-3387. PMID:18948745
  5. [ + ] Maggi LB Jr, et al. (2008) "Nucleophosmin serves as a rate-limiting nuclear export chaperone for the Mammalian ribosome." Mol Cell Biol. 28(23):7050-7065. PMID:18809582
  6. [ + ] Gandin V, et al. (2008) "Eukaryotic initiation factor 6 is rate-limiting in translation, growth and transformation." Nature. 455(7213):684-688. PMID:18784653
  7. [ + ] Bonetti P, et al. (2008) "Nucleophosmin and its AML-associated mutant regulate c-Myc turnover through Fbw7 gamma." J Cell Biol. 182(1):19-26. PMID:18625840
  8. [ + ] Falini B, et al. (2008) "Cytoplasmic mutated nucleophosmin is stable in primary leukemic cells and in a xenotransplant model of NPMc+ acute myeloid leukemia in SCID mice." Haematologica. 93(5):775-779. PMID:18367491
  9. [ + ] Sportoletti P, et al. (2008) "Npm1 is a haploinsufficient suppressor of myeloid and lymphoid malignancies in the mouse." Blood. 111(7):3859-3862. PMID:18212245
  10. [ + ] Yamauchi T, et al. (2008) "Ribosomal stress induces processing of Mybbp1a and its translocation from the nucleolus to the nucleoplasm." Genes Cells. 13(1):27-39. PMID:18173745
  11. [ + ] Zou Y, et al. (2008) "Nucleophosmin/B23 negatively regulates GCN5-dependent histone acetylation and transactivation." J Biol Chem. 283(9):5728-5737. PMID:18165222
  12. [ + ] Strand AD, et al. (2007) "Expression profiling of Huntington's disease models suggests that brain-derived neurotrophic factor depletion plays a major role in striatal degeneration." J Neurosci. 27(43):11758-11768. PMID:17959817
  13. [ + ] Li J, et al. (2007) "Nucleophosmin suppresses oncogene-induced apoptosis and senescence and enhances oncogenic cooperation in cells with genomic instability." Carcinogenesis. 28(6):1163-1170. PMID:17277230
  14. [ + ] Trinidad JC, et al. (2006) "Comprehensive identification of phosphorylation sites in postsynaptic density preparations." Mol Cell Proteomics. 5(5):914-922. PMID:16452087
  15. [ + ] Meng L, et al. (2006) "Multiple controls regulate nucleostemin partitioning between nucleolus and nucleoplasm." J Cell Sci. 119(Pt 24):5124-5136. PMID:17158916
  16. [ + ] Ma Z, et al. (2006) "Interaction between ROCK II and nucleophosmin/B23 in the regulation of centrosome duplication." Mol Cell Biol. 26(23):9016-9034. PMID:17015463
  17. [ + ] Wang BB, et al. (2006) "Inducible and reversible suppression of Npm1 gene expression using stably integrated small interfering RNA vector in mouse embryonic stem cells." Biochem Biophys Res Commun. 347(4):1129-1137. PMID:16870143
  18. [ + ] Romanova LG, et al. (2006) "Implication of nucleolar protein SURF6 in ribosome biogenesis and preimplantation mouse development." Biol Reprod. 75(5):690-696. PMID:16855206
  19. [ + ] Yu Y, et al. (2006) "Nucleophosmin is essential for ribosomal protein L5 nuclear export." Mol Cell Biol. 26(10):3798-3809. PMID:16648475
  20. [ + ] Zhang X, et al. (2006) "Proteomic analysis of macrophages stimulated by lipopolysaccharide: Lipopolysaccharide inhibits the cleavage of nucleophosmin." Electrophoresis. 27(8):1659-1668. PMID:16609939
  21. [ + ] Li J, et al. (2006) "Nucleophosmin regulates cell cycle progression and stress response in hematopoietic stem/progenitor cells." J Biol Chem. 281(24):16536-16545. PMID:16608843
  22. [ + ] Tarapore P, et al. (2006) "Thr199 phosphorylation targets nucleophosmin to nuclear speckles and represses pre-mRNA processing." FEBS Lett. 580(2):399-409. PMID:16376875
  23. [ + ] Lawson K, et al. (2005) "B23 is a downstream target of polyamine-modulated CK2." Mol Cell Biochem. 274(1-2):103-114. PMID:16342411
  24. [ + ] Huang N, et al. (2005) "Protein NPM3 interacts with the multifunctional nucleolar protein B23/nucleophosmin and inhibits ribosome biogenesis." J Biol Chem. 280(7):5496-5502. PMID:15596447
  25. [ + ] Meder VS, et al. (2005) "PARP-1 and PARP-2 interact with nucleophosmin/B23 and accumulate in transcriptionally active nucleoli." J Cell Sci. 118(Pt 1):211-222. PMID:15615785
  26. [ + ] Cairo S, et al. (2005) "PML interacts with Myc, and Myc target gene expression is altered in PML-null fibroblasts." Oncogene. 24(13):2195-2203. PMID:15735755
  27. [ + ] Yuan X, et al. (2005) "Genetic inactivation of the transcription factor TIF-IA leads to nucleolar disruption, cell cycle arrest, and p53-mediated apoptosis." Mol Cell. 19(1):77-87. PMID:15989966
  28. [ + ] Grisendi S, et al. (2005) "Role of nucleophosmin in embryonic development and tumorigenesis." Nature. 437(7055):147-153. PMID:16007073
  29. [ + ] Xiang YG, et al. (2005) "[Cloning and structural analysis of mouse genomic nucleophosmin gene]" Yi Chuan Xue Bao. 32(6):641-649. PMID:16018192
  30. [ + ] Lorenzen JA, et al. (2005) "Rbm19 is a nucleolar protein expressed in crypt/progenitor cells of the intestinal epithelium." Gene Expr Patterns. 6(1):45-56. PMID:16027046
  31. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  32. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  33. [ + ] Colombo E, et al. (2005) "Nucleophosmin is required for DNA integrity and p19Arf protein stability." Mol Cell Biol. 25(20):8874-8886. PMID:16199867
  34. [ + ] Shinmura K, et al. (2005) "Characterization of centrosomal association of nucleophosmin/B23 linked to Crm1 activity." FEBS Lett. 579(29):6621-6634. PMID:16297385
  35. [ + ] Shu H, et al. (2004) "Identification of phosphoproteins and their phosphorylation sites in the WEHI-231 B lymphoma cell line." Mol Cell Proteomics. 3(3):279-286. PMID:14729942
  36. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  37. [ + ] Brady SN, et al. (2004) "ARF impedes NPM/B23 shuttling in an Mdm2-sensitive tumor suppressor pathway." Mol Cell Biol. 24(21):9327-9338. PMID:15485902
  38. [ + ] Hayne C, et al. (2004) "MEK inhibition and phosphorylation of serine 4 on B23 are two coincident events in mitosis." Biochem Biophys Res Commun. 321(3):675-680. PMID:15358159
  39. [ + ] Garcia-Frigola C, et al. (2004) "A collection of cDNAs enriched in upper cortical layers of the embryonic mouse brain." Brain Res Mol Brain Res. 122(2):133-150. PMID:15010206
  40. [ + ] Burns KH, et al. (2003) "Roles of NPM2 in chromatin and nucleolar organization in oocytes and embryos." Science. 300(5619):633-636. PMID:12714744
  41. [ + ] Easterday MC, et al. (2003) "Neural progenitor genes. Germinal zone expression and analysis of genetic overlap in stem cell populations." Dev Biol. 264(2):309-322. PMID:14651920
  42. [ + ] Lange K, et al. (2003) "Overexpression of NPM-ALK induces different types of malignant lymphomas in IL-9 transgenic mice." Oncogene. 22(4):517-527. PMID:12555065
  43. [ + ] Wu MH, et al. (2002) "UV stimulation of nucleophosmin/B23 expression is an immediate-early gene response induced by damaged DNA." J Biol Chem. 277(50):48234-48240. PMID:12374805
  44. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  45. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  46. [ + ] Tsai RY, et al. (2002) "A nucleolar mechanism controlling cell proliferation in stem cells and cancer cells." Genes Dev. 16(23):2991-3003. PMID:12464630
  47. [ + ] Tarapore P, et al. (2002) "A mammalian in vitro centriole duplication system: evidence for involvement of CDK2/cyclin E and nucleophosmin/B23 in centrosome duplication." Cell Cycle. 1(1):75-81. PMID:12429912
  48. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  49. [ + ] Hemberger M, et al. (2000) "cDNA subtraction cloning reveals novel genes whose temporal and spatial expression indicates association with trophoblast invasion." Dev Biol. 222(1):158-169. PMID:10885754