abf-6 | GeneID:181418 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 181418 Official Symbol abf-6
Locus T22H6.7 Gene Type protein-coding
Synonyms
Full Name N/A
Description AntiBacterial Factor related
Chromosome N/A
Also Known As AntiBacterial Factor related family member (abf-6)
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_171787 NP_741914

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
T22H6.7 MI0000310 cel-miR-235 UAUUGCACUCUCCCCGGCCUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_171787  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene