abl-1 | GeneID:181261 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 181261 Official Symbol abl-1
Locus M79.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description related to oncogene ABL
Chromosome N/A
Also Known As related to oncogene ABL family member (abl-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 116014

ID Symbol Protein Species
GeneID:181261 abl-1 NP_509778.2 Caenorhabditis elegans
GeneID:816972 AT2G24360 NP_565568.1 Arabidopsis thaliana
GeneID:829245 AT4G31170 NP_001031758.1 Arabidopsis thaliana
GeneID:4328462 Os02g0174200 NP_001046047.1 Oryza sativa
GeneID:4336935 Os04g0608900 NP_001053818.1 Oryza sativa
GeneID:4341763 Os06g0663400 NP_001058291.1 Oryza sativa
GeneID:4344967 Os08g0224100 NP_001061274.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0005515 Function protein binding
GO:0004672 Function protein kinase activity
GO:0004674 Function protein serine/threonine kinase activity
GO:0004713 Function protein tyrosine kinase activity
GO:0000077 Process DNA damage checkpoint
GO:0043066 Process negative regulation of apoptosis
GO:0043518 Process negative regulation of DNA damage response, signal transduction by p53 class mediator
GO:0006468 Process protein amino acid phosphorylation
GO:0010212 Process response to ionizing radiation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_077376 NP_509777
2 NM_077377 NP_509778
3 NM_077378 NP_509779

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
M79.1b MI0000313 cel-miR-238 UUUGUACUCCGAUGCCAUUCAGA
M79.1b MI0000323 cel-miR-247 UGACUAGAGCCUAUUCUCUUCU
M79.1b MI0000336 cel-miR-259 AAAUCUCAUCCUAAUCUGGUAGCA
M79.1b MI0000350 cel-miR-270 GGCAUGAUGUAGCAGUGGAG
M79.1b MI0000015 cel-miR-44 UGACUAGAGACACAUUCAGCU
M79.1b MI0000042 cel-miR-71 UGAAAGACAUGGGUAGUGA
M79.1c MI0000313 cel-miR-238 UUUGUACUCCGAUGCCAUUCAGA
M79.1c MI0000322 cel-miR-246 UUACAUGUUUCGGGUAGGAGC
M79.1c MI0000336 cel-miR-259 AAAUCUCAUCCUAAUCUGGUAGCA
M79.1c MI0000350 cel-miR-270 GGCAUGAUGUAGCAGUGGAG
M79.1c MI0000042 cel-miR-71 UGAAAGACAUGGGUAGUGA
M79.1c MI0000048 cel-miR-77 UUCAUCAGGCCAUAGCUGUCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Salinas LS, et al. (2006) "Stress-induced germ cell apoptosis by a p53 independent pathway in Caenorhabditis elegans." Cell Death Differ. 13(12):2129-2139. PMID:16729024
  2. [ + ] Burton EA, et al. (2006) "The Caenorhabditis elegans ABL-1 tyrosine kinase is required for Shigella flexneri pathogenesis." Appl Environ Microbiol. 72(7):5043-5051. PMID:16820504
  3. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  4. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719