abts-4 | GeneID:180943 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 180943 Official Symbol abts-4
Locus R03E9.3 Gene Type protein-coding
Synonyms
Full Name N/A
Description Anion/Bicarbonate TranSporter family
Chromosome N/A
Also Known As Anion/Bicarbonate TranSporter family member (abts-4)
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0015380 Function anion exchanger activity
GO:0008509 Function anion transmembrane transporter activity
GO:0005452 Function inorganic anion exchanger activity
GO:0006820 Process anion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001029655 NP_001024826
2 NM_001029656 NP_001024827
3 NM_001129697 NP_001123169
4 NM_001129698 NP_001123170

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
R03E9.3a MI0000317 cel-miR-241 UGAGGUAGGUGCGAGAAAUGA
R03E9.3a MI0000345 cel-miR-265 UGAGGGAGGAAGGGUGGUAU
R03E9.3a MI0000352 cel-miR-272 UGUAGGCAUGGGUGUUUG
R03E9.3a MI0000055 cel-miR-84 UGAGGUAGUAUGUAAUAUUGUA
R03E9.3b MI0000304 cel-miR-229 AAUGACACUGGUUAUCUUUUCCAUCG
R03E9.3b MI0000317 cel-miR-241 UGAGGUAGGUGCGAGAAAUGA
R03E9.3b MI0000352 cel-miR-272 UGUAGGCAUGGGUGUUUG
R03E9.3b MI0005189 cel-miR-789 UCCCUGCCUGGGUCACCAAUUGU
R03E9.3b MI0005190 cel-miR-789 UCCCUGCCUGGGUCACCAAUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719