aat-3 | GeneID:180557 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 180557 Official Symbol aat-3
Locus F52H2.2 Gene Type protein-coding
Synonyms
Full Name N/A
Description Amino Acid Transporter
Chromosome N/A
Also Known As Amino Acid Transporter family member (aat-3)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 8166

ID Symbol Protein Species
GeneID:23428 SLC7A8 NP_036376.2 Homo sapiens
GeneID:43707 CG1607 NP_733427.1 Drosophila melanogaster
GeneID:50934 Slc7a8 NP_058668.1 Mus musculus
GeneID:84551 Slc7a8 NP_445894.1 Rattus norvegicus
GeneID:177793 aat-1 NP_501707.1 Caenorhabditis elegans
GeneID:180557 aat-3 NP_508461.1 Caenorhabditis elegans
GeneID:452793 SLC7A8 XP_001161667.1 Pan troglodytes
GeneID:490608 SLC7A8 XP_547730.1 Canis lupus familiaris
GeneID:536818 SLC7A8 XP_616962.2 Bos taurus
GeneID:1281545 AgaP_AGAP001627 XP_321470.2 Anopheles gambiae
GeneID:100007704 LOC100007704 XP_001344096.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0015171 Function amino acid transmembrane transporter activity
GO:0006865 Process amino acid transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_076060 NP_508461

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F52H2.2 MI0000311 cel-miR-236 UAAUACUGUCAGGUAAUGACGCU
F52H2.2 MI0000339 cel-miR-262 GUUUCUCGAUGUUUUCUGAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_076060  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719