ABAT | GeneID:18 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 18 Official Symbol ABAT
Locus N/A Gene Type protein-coding
Synonyms FLJ17813; GABA-AT; GABAT; NPD009
Full Name 4-aminobutyrate aminotransferase
Description 4-aminobutyrate aminotransferase
Chromosome 16p13.2
Also Known As 4-aminobutyrate transaminase; GABA aminotransferase; GABA transferase; gamma-amino-N-butyrate transaminase
Summary 4-aminobutyrate aminotransferase (ABAT) is responsible for catabolism of gamma-aminobutyric acid (GABA), an important, mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. The active enzyme is a homodimer of 50-kD subunits complexed to pyridoxal-5-phosphate. The protein sequence is over 95% similar to the pig protein. GABA is estimated to be present in nearly one-third of human synapses. ABAT in liver and brain is controlled by 2 codominant alleles with a frequency in a Caucasian population of 0.56 and 0.44. The ABAT deficiency phenotype includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Multiple alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 542

ID Symbol Protein Species
GeneID:18 ABAT NP_000654.2 Homo sapiens
GeneID:40188 CG7433 NP_649168.2 Drosophila melanogaster
GeneID:81632 Abat NP_112265.1 Rattus norvegicus
GeneID:177897 gta-1 NP_501862.1 Caenorhabditis elegans
GeneID:268860 Abat NP_766549.2 Mus musculus
GeneID:378968 abat NP_958906.1 Danio rerio
GeneID:416642 ABAT XP_414940.2 Gallus gallus
GeneID:453903 ABAT XP_001137090.1 Pan troglodytes
GeneID:479856 ABAT XP_851424.1 Canis lupus familiaris
GeneID:506219 ABAT XP_582638.2 Bos taurus
GeneID:852902 UGA1 NP_011533.1 Saccharomyces cerevisiae
GeneID:1270119 AgaP_AGAP006966 XP_308791.2 Anopheles gambiae
GeneID:2542494 SPAC19D5.07 NP_594905.1 Schizosaccharomyces pombe
GeneID:2679339 MGG_01662 XP_363736.1 Magnaporthe grisea
GeneID:2713300 NCU08998.1 XP_331390.1 Neurospora crassa
GeneID:2895485 KLLA0F20548g XP_456003.1 Kluyveromyces lactis
GeneID:4622915 AGOS_AGL050C NP_986616.1 Eremothecium gossypii

Exon, Intron and UTRs

Exon, Intron and UTRs of ABAT Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABAT Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0032144 Component 4-aminobutyrate transaminase complex
GO:0005759 Component mitochondrial matrix
GO:0005739 Component mitochondrion
GO:0003867 Function 4-aminobutyrate transaminase activity
GO:0005515 Function protein binding
GO:0042803 Function protein homodimerization activity
GO:0030170 Function pyridoxal phosphate binding
GO:0047298 Function (S)-3-amino-2-methylpropionate transaminase activity
GO:0032145 Function succinate-semialdehyde dehydrogenase binding
GO:0016740 Function transferase activity
GO:0007610 Process behavior
GO:0048148 Process behavioral response to cocaine
GO:0009450 Process gamma-aminobutyric acid catabolic process
GO:0042135 Process neurotransmitter catabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000663  UCSC Browser NP_000654
2 NM_001127448  UCSC Browser NP_001120920
3 NM_020686  UCSC Browser NP_065737

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000268251 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENST00000268251 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABAT mRNA
17562736
aluminum chloride
  • aluminum chloride results in decreased activity of ABAT protein
11696403
Calcitriol
  • Calcitriol results in increased expression of ABAT mRNA
16002434
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABAT mRNA
17484886
decamethrin
  • decamethrin affects the activity of ABAT protein
15189238
Dietary Fats
  • Dietary Fats results in increased expression of ABAT mRNA
18042831
Estradiol
  • Estradiol affects the expression of ABAT mRNA
14699072
Estradiol
  • [Progesterone co-treated with Estradiol] results in increased expression of ABAT mRNA
17404688
hydroxytamoxifen
  • hydroxytamoxifen results in decreased expression of ABAT mRNA
16849584
Methapyrilene
  • Methapyrilene results in decreased expression of ABAT mRNA
16393664
palm oil
  • palm oil results in increased expression of ABAT mRNA
18042831
Permethrin
  • Permethrin affects the activity of ABAT protein
15189238
Progesterone
  • [Progesterone co-treated with Estradiol] results in increased expression of ABAT mRNA
17404688
Vigabatrin
  • Vigabatrin results in decreased activity of ABAT protein
15869561
Vigabatrin
  • Vigabatrin results in decreased activity of ABAT protein
15639145

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Ataxia marker
Mental Retardation marker
Metabolism, Inborn Errors marker
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15845082, 15380490
Breast Neoplasms inferred via Progesterone 17614352, 15562024, 16175315
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Dermatitis, Contact inferred via Permethrin 14617103
Insect Bites and Stings inferred via Permethrin 15189238, 12971516, 12749493
Leukemia inferred via Permethrin 12937054
Liver Neoplasms inferred via Methapyrilene 15890375
Breast Neoplasms inferred via Estradiol 17289903, 18497071, 17018787, 14630087, 12948864, 17261762
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 16891317, 11408345
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Insect Bites and Stings inferred via decamethrin 15189238
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16050911, 16097048, 16124888, 16227642, 15700767, 10355542, 16011737
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 16239168, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 15998439, 15027814, 15968718, 16227642, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16239168, 17334410, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 15925388, 17525996, 17557913, 18156304, 16638106, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 18395095, 17976157, 17805973, 16248980
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15830285, 16964402, 15720792, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16289102, 16644109
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 17562736, 14986274, 16177239, 16227642, 15968718
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ALDH5A1 ABAT / ALDH5A1 Reconstituted Complex Hearl WG (1984)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Inada T, et al. (2008) "Pathway-based association analysis of genome-wide screening data suggest that genes associated with the gamma-aminobutyric acid receptor signaling pathway are involved in neuroleptic-induced, treatment-resistant tardive dyskinesia." Pharmacogenet Genomics. 18(4):317-323. PMID:18334916
  2. [ + ] Wu C, et al. (2007) "Systematic identification of SH3 domain-mediated human protein-protein interactions by peptide array target screening." Proteomics. 7(11):1775-1785. PMID:17474147
  3. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  4. [ + ] Zhang B, et al. (2005) "An association study between polymorphisms in five genes in glutamate and GABA pathway and paranoid schizophrenia." Eur Psychiatry. 20(1):45-49. PMID:15642443
  5. [ + ] Barnby G, et al. (2005) "Candidate-gene screening and association analysis at the autism-susceptibility locus on chromosome 16p: evidence of association at GRIN2A and ABAT." Am J Hum Genet. 76(6):950-966. PMID:15830322
  6. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  7. [ + ] Kim DW, et al. (2004) "Site-directed mutagenesis of human brain GABA transaminase: lysine-357 is involved in cofactor binding at the active site." Mol Cells. 18(3):314-319. PMID:15650327
  8. [ + ] Yoon CS, et al. (2004) "Cysteine-321 of human brain GABA transaminase is involved in intersubunit cross-linking." Mol Cells. 18(2):214-219. PMID:15528998
  9. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  10. [ + ] Rainesalo S, et al. (2003) "Uptake of GABA and activity of GABA-transaminase in platelets from epileptic patients." Epilepsy Res. 53(3):233-239. PMID:12694932
  11. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  12. [ + ] Cohen BI, et al. (2001) "GABA-transaminase, the liver and infantile autism." Med Hypotheses. 57(6):673-674. PMID:11918424
  13. [ + ] Jeon SG, et al. (2000) "Human brain GABA transaminase tissue distribution and molecular expression." Eur J Biochem. 267(17):5601-5607. PMID:10951220
  14. [ + ] Medina-Kauwe LK, et al. (1999) "4-Aminobutyrate aminotransferase (GABA-transaminase) deficiency." J Inherit Metab Dis. 22(4):414-427. PMID:10407778
  15. [ + ] Osei YD, et al. (1995) "Screening and sequence determination of a cDNA encoding the human brain 4-aminobutyrate aminotransferase." Gene. 155(2):185-187. PMID:7721088
  16. [ + ] De Biase D, et al. (1995) "Primary structure and tissue distribution of human 4-aminobutyrate aminotransferase." Eur J Biochem. 227(1-2):476-480. PMID:7851425
  17. [ + ] Hearl WG, et al. (1984) "Interactions between 4-aminobutyrate aminotransferase and succinic semialdehyde dehydrogenase, two mitochondrial enzymes." J Biol Chem. 259(18):11459-11463. PMID:6470007
  18. [ + ] Jaeken J, et al. (1984) "Gamma-aminobutyric acid-transaminase deficiency: a newly recognized inborn error of neurotransmitter metabolism." Neuropediatrics. 15(3):165-169. PMID:6148708
  19. [ + ] Jeremiah S, et al. (1981) "The biochemical genetics of human gamma-aminobutyric acid transaminase." Ann Hum Genet. 45(Pt 3):231-236. PMID:7305280