abcf-1 | GeneID:179748 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 179748 Official Symbol abcf-1
Locus F18E2.2 Gene Type protein-coding
Synonyms
Full Name N/A
Description ABC transporter, class F
Chromosome N/A
Also Known As ABC transporter, class F family member (abcf-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 849

ID Symbol Protein Species
GeneID:23 ABCF1 NP_001020262.1 Homo sapiens
GeneID:32112 CG1703 NP_572736.1 Drosophila melanogaster
GeneID:85493 Abcf1 XP_001062137.1 Rattus norvegicus
GeneID:179748 abcf-1 NP_506192.1 Caenorhabditis elegans
GeneID:224742 Abcf1 NP_038882.1 Mus musculus
GeneID:406467 abcf1 NP_998351.1 Danio rerio
GeneID:462543 ABCF1 NP_001035838.1 Pan troglodytes
GeneID:474826 ABCF1 XP_532056.2 Canis lupus familiaris
GeneID:525343 ABCF1 XP_603695.3 Bos taurus
GeneID:824619 ATGCN4 NP_567001.1 Arabidopsis thaliana
GeneID:1280440 AgaP_AGAP012249 XP_320293.2 Anopheles gambiae
GeneID:2539509 SPCC825.01 NP_588051.1 Schizosaccharomyces pombe
GeneID:4333216 Os03g0441500 NP_001050461.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0009792 Process embryonic development ending in birth or egg hatching
GO:0040035 Process hermaphrodite genitalia development
GO:0000003 Process reproduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_073791 NP_506192

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F18E2.2 MI0000346 cel-miR-266 AGGCAAGACUUUGGCAAAGC
F18E2.2 MI0000349 cel-miR-269 GGCAAGACUCUGGCAAAACU
F18E2.2 MI0000008 cel-miR-37 UCACCGGGUGAACACUUGCAGU
F18E2.2 MI0000034 cel-miR-63 UAUGACACUGAAGCGAGUUGGAAA
F18E2.2 MI0000035 cel-miR-64 UAUGACACUGAAGCGUUACCGAA
F18E2.2 MI0000036 cel-miR-65 UAUGACACUGAAGCGUAACCGAA
F18E2.2 MI0000037 cel-miR-66 CAUGACACUGAUUAGGGAUGUGA
F18E2.2 MI0000043 cel-miR-72 AGGCAAGAUGUUGGCAUAGCUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_073791  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sonnichsen B, et al. (2005) "Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans." Nature. 434(7032):462-469. PMID:15791247
  2. [ + ] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431
  3. [ + ] Rual JF, et al. (2004) "Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library." Genome Res. 14(10B):2162-2168. PMID:15489339
  4. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  5. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719