abcf-1 | GeneID:179748 | Caenorhabditis elegans
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 179748 | Official Symbol | abcf-1 |
|---|---|---|---|
| Locus | F18E2.2 | Gene Type | protein-coding |
| Synonyms | |||
| Full Name | N/A | ||
| Description | ABC transporter, class F | ||
| Chromosome | N/A | ||
| Also Known As | ABC transporter, class F family member (abcf-1) | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 849
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:23 | ABCF1 | NP_001020262.1 | Homo sapiens |
| GeneID:32112 | CG1703 | NP_572736.1 | Drosophila melanogaster |
| GeneID:85493 | Abcf1 | XP_001062137.1 | Rattus norvegicus |
| GeneID:179748 | abcf-1 | NP_506192.1 | Caenorhabditis elegans |
| GeneID:224742 | Abcf1 | NP_038882.1 | Mus musculus |
| GeneID:406467 | abcf1 | NP_998351.1 | Danio rerio |
| GeneID:462543 | ABCF1 | NP_001035838.1 | Pan troglodytes |
| GeneID:474826 | ABCF1 | XP_532056.2 | Canis lupus familiaris |
| GeneID:525343 | ABCF1 | XP_603695.3 | Bos taurus |
| GeneID:824619 | ATGCN4 | NP_567001.1 | Arabidopsis thaliana |
| GeneID:1280440 | AgaP_AGAP012249 | XP_320293.2 | Anopheles gambiae |
| GeneID:2539509 | SPCC825.01 | NP_588051.1 | Schizosaccharomyces pombe |
| GeneID:4333216 | Os03g0441500 | NP_001050461.1 | Oryza sativa |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016887 | Function | ATPase activity |
| GO:0005524 | Function | ATP binding |
| GO:0017111 | Function | nucleoside-triphosphatase activity |
| GO:0000166 | Function | nucleotide binding |
| GO:0009792 | Process | embryonic development ending in birth or egg hatching |
| GO:0040035 | Process | hermaphrodite genitalia development |
| GO:0000003 | Process | reproduction |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| F18E2.2 | MI0000346 | cel-miR-266 | AGGCAAGACUUUGGCAAAGC |
| F18E2.2 | MI0000349 | cel-miR-269 | GGCAAGACUCUGGCAAAACU |
| F18E2.2 | MI0000008 | cel-miR-37 | UCACCGGGUGAACACUUGCAGU |
| F18E2.2 | MI0000034 | cel-miR-63 | UAUGACACUGAAGCGAGUUGGAAA |
| F18E2.2 | MI0000035 | cel-miR-64 | UAUGACACUGAAGCGUUACCGAA |
| F18E2.2 | MI0000036 | cel-miR-65 | UAUGACACUGAAGCGUAACCGAA |
| F18E2.2 | MI0000037 | cel-miR-66 | CAUGACACUGAUUAGGGAUGUGA |
| F18E2.2 | MI0000043 | cel-miR-72 | AGGCAAGAUGUUGGCAUAGCUGA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Sonnichsen B, et al. (2005) "Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans." Nature. 434(7032):462-469. PMID:15791247 - [
] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431 - [
] Rual JF, et al. (2004) "Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library." Genome Res. 14(10B):2162-2168. PMID:15489339 - [
] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011 - [
] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719
A key challenge of functional genomics today is to generate well-annotated data sets that can be interpreted across different platforms and technologies. Large-scale functional genomics data often fail to connect to standard experimental approaches of gene characterization in individual laboratories. Furthermore, a lack of universal annotation standards for phenotypic data sets makes it difficult to compare different screening approaches. Here we address this problem in a screen designed to identify all genes required for the first two rounds of cell division in the Caenorhabditis elegans embryo. We used RNA-mediated interference to target 98% of all genes predicted in the C. elegans genome in combination with differential interference contrast time-lapse microscopy. Through systematic annotation of the resulting movies, we developed a phenotypic profiling system, which shows high correlation with cellular processes and biochemical pathways, thus enabling us to predict new functions for previously uncharacterized genes.
To initiate studies on how protein-protein interaction (or "interactome") networks relate to multicellular functions, we have mapped a large fraction of the Caenorhabditis elegans interactome network. Starting with a subset of metazoan-specific proteins, more than 4000 interactions were identified from high-throughput, yeast two-hybrid (HT=Y2H) screens. Independent coaffinity purification assays experimentally validated the overall quality of this Y2H data set. Together with already described Y2H interactions and interologs predicted in silico, the current version of the Worm Interactome (WI5) map contains approximately 5500 interactions. Topological and biological features of this interactome network, as well as its integration with phenome and transcriptome data sets, lead to numerous biological hypotheses.
The recently completed Caenorhabditis elegans genome sequence allows application of high-throughput (HT) approaches for phenotypic analyses using RNA interference (RNAi). As large phenotypic data sets become available, "phenoclustering" strategies can be used to begin understanding the complex molecular networks involved in development and other biological processes. The current HT-RNAi resources represent a great asset for phenotypic profiling but are limited by lack of flexibility. For instance, existing resources do not take advantage of the latest improvements in RNAi technology, such as inducible hairpin RNAi. Here we show that a C. elegans ORFeome resource, generated with the Gateway cloning system, can be used as a starting point to generate alternative HT-RNAi resources with enhanced flexibility. The versatility inherent to the Gateway system suggests that additional HT-RNAi libraries can now be readily generated to perform gene knockdowns under various conditions, increasing the possibilities for phenome mapping in C. elegans.
InterPro, an integrated documentation resource of protein families, domains and functional sites, was created in 1999 as a means of amalgamating the major protein signature databases into one comprehensive resource. PROSITE, Pfam, PRINTS, ProDom, SMART and TIGRFAMs have been manually integrated and curated and are available in InterPro for text- and sequence-based searching. The results are provided in a single format that rationalises the results that would be obtained by searching the member databases individually. The latest release of InterPro contains 5629 entries describing 4280 families, 1239 domains, 95 repeats and 15 post-translational modifications. Currently, the combined signatures in InterPro cover more than 74% of all proteins in SWISS-PROT and TrEMBL, an increase of nearly 15% since the inception of InterPro. New features of the database include improved searching capabilities and enhanced graphical user interfaces for visualisation of the data. The database is available via a webserver (http://www.ebi.ac.uk/interpro) and anonymous FTP (ftp://ftp.ebi.ac.uk/pub/databases/interpro).
Gene Ontology Annotation (GOA) is a project run by the European Bioinformatics Institute (EBI) that aims to provide assignments of terms from the Gene Ontology (GO) resource to gene products in a number of its databases (http://www.ebi.ac.uk/GOA). In the first stage of this project, GO assignments have been applied to a data set representing the complete human proteome by a combination of electronic mappings and manual curation. This vocabulary has also been applied to the nonredundant proteome sets for all other completely sequenced organisms as well as to proteins from a wide range of organisms where the proteome is not yet complete.