6-phosphofructokinase | GeneID:179335 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 179335 Official Symbol 6-phosphofructokinase
Locus C50F4.2 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_073056 NP_505457

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C50F4.2 MI0000758 cel-miR-359 UCACUGGUCUUUCUCUGACGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_073056  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

CAA94737   NP_505457   Q27483   T20109  

Transcript Cluster

[ - ] NCBI's UniGene