abu-8 | GeneID:178904 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 178904 Official Symbol abu-8
Locus C03A7.14 Gene Type protein-coding
Synonyms
Full Name N/A
Description Activated in Blocked Unfolded protein response
Chromosome N/A
Also Known As Activated in Blocked Unfolded protein response family member (abu-8)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 114070

ID Symbol Protein Species
GeneID:173404 abu-11 NP_493679.1 Caenorhabditis elegans
GeneID:174337 M195.2 NP_495760.2 Caenorhabditis elegans
GeneID:174407 F07H5.8 NP_495874.1 Caenorhabditis elegans
GeneID:174464 pqn-95 NP_495966.2 Caenorhabditis elegans
GeneID:174597 M02G9.1 NP_496223.2 Caenorhabditis elegans
GeneID:178903 abu-6 NP_504383.1 Caenorhabditis elegans
GeneID:178904 abu-8 NP_504393.1 Caenorhabditis elegans
GeneID:178954 pqn-13 NP_504494.2 Caenorhabditis elegans
GeneID:181800 abu-1 NP_505667.1 Caenorhabditis elegans
GeneID:181801 pqn-2 NP_505668.2 Caenorhabditis elegans
GeneID:182136 pqn-5 NP_504382.1 Caenorhabditis elegans
GeneID:182139 abu-7 NP_504384.1 Caenorhabditis elegans
GeneID:182836 pqn-16 NP_505378.1 Caenorhabditis elegans
GeneID:184695 abu-2 NP_508265.1 Caenorhabditis elegans
GeneID:185133 abu-3 NP_510839.1 Caenorhabditis elegans
GeneID:185248 abu-10 NP_508659.1 Caenorhabditis elegans
GeneID:185249 F35A5.4 NP_508657.2 Caenorhabditis elegans
GeneID:187405 M02G9.2 NP_496222.2 Caenorhabditis elegans
GeneID:187406 M02G9.3 NP_496221.1 Caenorhabditis elegans
GeneID:187728 pqn-54 NP_503423.1 Caenorhabditis elegans
GeneID:187749 abu-9 NP_509407.1 Caenorhabditis elegans
GeneID:187751 pqn-57 NP_509406.1 Caenorhabditis elegans
GeneID:188802 pqn-71 NP_506849.1 Caenorhabditis elegans
GeneID:190671 pqn-90 NP_502843.1 Caenorhabditis elegans
GeneID:190672 pqn-91 NP_502844.1 Caenorhabditis elegans
GeneID:190869 pqn-76 NP_502872.1 Caenorhabditis elegans
GeneID:190870 abu-5 NP_502873.1 Caenorhabditis elegans
GeneID:190871 pqn-78 NP_502874.1 Caenorhabditis elegans
GeneID:190872 pqn-79 NP_502875.1 Caenorhabditis elegans
GeneID:353458 abu-4 NP_872210.1 Caenorhabditis elegans
GeneID:3896863 Y5H2A.4 NP_001033518.1 Caenorhabditis elegans

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005515 Function protein binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_071992 NP_504393

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C03A7.14 MI0000308 cel-miR-233 UUGAGCAAUGCGCAUGUGCGG
C03A7.14 MI0000755 cel-miR-356 UUGAGCAACGCGAACAAAUCA
C03A7.14 MI0000022 cel-miR-51 UACCCGUAGCUCCUAUCCAUGUU
C03A7.14 MI0000024 cel-miR-53 CACCCGUACAUUUGUUUCCGUGCU
C03A7.14 MI0000025 cel-miR-54 UACCCGUAAUCUUCAUAAUCCGAG
C03A7.14 MI0000026 cel-miR-55 UACCCGUAUAAGUUUCUGCUGAG
C03A7.14 MI0000027 cel-miR-56 UACCCGUAAUGUUUCCGCUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_071992  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
resveratrol
  • resveratrol results in increased expression of ABU-8 mRNA
16256736

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
abu-1 abu-1 / abu-8 Two-hybrid Tewari M (2004)
abu-11 abu-11 / abu-8 Two-hybrid Li S (2004)
gip-1 gip-1 / abu-8 Two-hybrid Li S (2004)
gst-23 gst-23 / abu-8 Two-hybrid Li S (2004)
N/A N/A / abu-8 Two-hybrid Li S (2004)
pqn-5 pqn-5 / abu-8 Two-hybrid Li S (2004)
pqn-54 pqn-54 / abu-8 Two-hybrid Li S (2004)
pqn-71 pqn-71 / abu-8 Two-hybrid Li S (2004)
pqn-71 pqn-71 / abu-8 Two-hybrid Tewari M (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431
  2. [ + ] Tewari M, et al. (2004) "Systematic interactome mapping and genetic perturbation analysis of a C. elegans TGF-beta signaling network." Mol Cell. 13(4):469-482. PMID:14992718