abt-4 | GeneID:178559 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 178559 Official Symbol abt-4
Locus Y39D8C.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description ABC Transporter family
Chromosome N/A
Also Known As ABC Transporter family member (abt-4)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37437

ID Symbol Protein Species
GeneID:21 ABCA3 NP_001080.2 Homo sapiens
GeneID:27410 Abca3 NP_001034670.1 Mus musculus
GeneID:33103 CG1718 NP_608445.1 Drosophila melanogaster
GeneID:178559 abt-4 NP_503175.1 Caenorhabditis elegans
GeneID:302973 Abca3 XP_220219.4 Rattus norvegicus
GeneID:416386 ABCA3 XP_414701.2 Gallus gallus
GeneID:453833 ABCA3 XP_510744.2 Pan troglodytes
GeneID:479879 ABCA3 XP_537004.2 Canis lupus familiaris
GeneID:505787 ABCA3 XP_582132.3 Bos taurus
GeneID:1269722 AgaP_AGAP007504 XP_308371.2 Anopheles gambiae
GeneID:1276992 AgaP_AGAP006379 XP_557048.1 Anopheles gambiae
GeneID:1280527 AgaP_AGAP012156 XP_552044.1 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_070774 NP_503175

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
Y39D8C.1 MI0000044 cel-miR-73 UGGCAAGAUGUAGGCAGUUCAGU
Y39D8C.1 MI0000045 cel-miR-74 UGGCAAGAAAUGGCAGUCUACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_070774  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719