6-phosphofructo-2-kinase | GeneID:177363 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 177363 Official Symbol 6-phosphofructo-2-kinase
Locus K02B2.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 88708

ID Symbol Protein Species
GeneID:5209 PFKFB3 NP_004557.1 Homo sapiens
GeneID:117276 Pfkfb3 NP_476476.1 Rattus norvegicus
GeneID:170768 Pfkfb3 NP_573495.2 Mus musculus
GeneID:172147 phosphofructokinase NP_491529.2 Caenorhabditis elegans
GeneID:177363 6-phosphofructo-2-kinase NP_500893.2 Caenorhabditis elegans
GeneID:418247 PFKFB3 XP_416472.2 Gallus gallus
GeneID:487139 PFKFB3 XP_544267.2 Canis lupus familiaris
GeneID:554477 pfkfb3 NP_998562.1 Danio rerio
GeneID:738397 PFKFB3 XP_001147864.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_068492 NP_500893

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
K02B2.1 MI0000320 cel-miR-244 UCUUUGGUUGUACAAAGUGGUAUG
K02B2.1 MI0000023 cel-miR-52 CACCCGUACAUAUGUUUCCGUGCU
K02B2.1 MI0005187 cel-miR-787 UAAGCUCGUUUUAGUAUCUUUCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_068492  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene