mca-3 | GeneID:177089 | Caenorhabditis elegans
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 177089 | Official Symbol | mca-3 |
|---|---|---|---|
| Locus | Y67D8C.10 | Gene Type | protein-coding |
| Synonyms | |||
| Full Name | N/A | ||
| Description | Membrane Calcium ATPase | ||
| Chromosome | N/A | ||
| Also Known As | Membrane Calcium ATPase family member (mca-3) | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 49690
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:492 | ATP2B3 | NP_001001344.1 | Homo sapiens |
| GeneID:29599 | Atp2b3 | XP_343840.2 | Rattus norvegicus |
| GeneID:43787 | CG2165 | NP_001014689.1 | Drosophila melanogaster |
| GeneID:177004 | ATPase | NP_500161.1 | Caenorhabditis elegans |
| GeneID:177089 | mca-3 | NP_001023556.1 | Caenorhabditis elegans |
| GeneID:320707 | Atp2b3 | NP_796210.2 | Mus musculus |
| GeneID:492238 | ATP2B3 | XP_853260.1 | Canis lupus familiaris |
| GeneID:504353 | ATP2B3 | XP_001251088.1 | Bos taurus |
| GeneID:558525 | atp2b3b | XP_686848.3 | Danio rerio |
| GeneID:818754 | ACA4 | NP_181687.1 | Arabidopsis thaliana |
| GeneID:824900 | ACA11 | NP_191292.1 | Arabidopsis thaliana |
| GeneID:1272551 | AgaP_AGAP010638 | XP_311357.2 | Anopheles gambiae |
| GeneID:4326507 | Os01g0939100 | NP_001045345.1 | Oryza sativa |
| GeneID:4339199 | Os05g0495600 | NP_001055932.1 | Oryza sativa |
| GeneID:4349735 | Os11g0140400 | NP_001065710.1 | Oryza sativa |
| GeneID:4351449 | Os12g0136900 | NP_001066105.1 | Oryza sativa |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0015662 | Function | ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism |
| GO:0005524 | Function | ATP binding |
| GO:0015085 | Function | calcium ion transmembrane transporter activity |
| GO:0005388 | Function | calcium-transporting ATPase activity |
| GO:0003824 | Function | catalytic activity |
| GO:0016820 | Function | hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances |
| GO:0006754 | Process | ATP biosynthetic process |
| GO:0006816 | Process | calcium ion transport |
| GO:0006812 | Process | cation transport |
| GO:0008340 | Process | determination of adult life span |
| GO:0009792 | Process | embryonic development ending in birth or egg hatching |
| GO:0006897 | Process | endocytosis |
| GO:0040011 | Process | locomotion |
| GO:0008152 | Process | metabolic process |
| GO:0002119 | Process | nematode larval development |
| GO:0045807 | Process | positive regulation of endocytosis |
| GO:0040010 | Process | positive regulation of growth rate |
| GO:0040017 | Process | positive regulation of locomotion |
| GO:0051481 | Process | reduction of cytosolic calcium ion concentration |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001028385 | NP_001023556 | |
| 2 | NM_067893 | NP_500294 | |
| 3 | NM_171299 | NP_741352 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| Y67D8C.10a | MI0000312 | cel-miR-237 | UCCCUGAGAAUUCUCGAACAGCU |
| Y67D8C.10a | MI0000006 | cel-miR-35 | UCACCGGGUGGAAACUAGCAGU |
| Y67D8C.10a | MI0000007 | cel-miR-36 | UCACCGGGUGAAAAUUCGCAUG |
| Y67D8C.10a | MI0000008 | cel-miR-37 | UCACCGGGUGAACACUUGCAGU |
| Y67D8C.10a | MI0000009 | cel-miR-38 | UCACCGGGAGAAAAACUGGAGU |
| Y67D8C.10a | MI0000010 | cel-miR-39 | UCACCGGGUGUAAAUCAGCUUG |
| Y67D8C.10a | MI0000011 | cel-miR-40 | UCACCGGGUGUACAUCAGCUAA |
| Y67D8C.10a | MI0000012 | cel-miR-41 | UCACCGGGUGAAAAAUCACCUA |
| Y67D8C.10a | MI0000013 | cel-miR-42 | UCACCGGGUUAACAUCUACAGA |
| Y67D8C.10c | MI0000312 | cel-miR-237 | UCCCUGAGAAUUCUCGAACAGCU |
| Y67D8C.10c | MI0000353 | cel-miR-273 | UGCCCGUACUGUGUCGGCUG |
| Y67D8C.10c | MI0000007 | cel-miR-36 | UCACCGGGUGAAAAUUCGCAUG |
| Y67D8C.10c | MI0000009 | cel-miR-38 | UCACCGGGAGAAAAACUGGAGU |
| Y67D8C.10c | MI0000011 | cel-miR-40 | UCACCGGGUGUACAUCAGCUAA |
| Y67D8C.10c | MI0000012 | cel-miR-41 | UCACCGGGUGAAAAAUCACCUA |
| Y67D8C.10c | MI0000013 | cel-miR-42 | UCACCGGGUUAACAUCUACAGA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Bednarek EM, et al. (2007) "The plasma membrane calcium ATPase MCA-3 is required for clathrin-mediated endocytosis in scavenger cells of Caenorhabditis elegans." Traffic. 8(5):543-553. PMID:17343680 - [
] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011 - [
] Kamath RS, et al. (2003) "Systematic functional analysis of the Caenorhabditis elegans genome using RNAi." Nature. 421(6920):231-237. PMID:12529635 - [
] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719 - [
] Simmer F, et al. (2003) "Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions." PLoS Biol. 1(1):E12. PMID:14551910 - [
] Fares H, et al. (2001) "Genetic analysis of endocytosis in Caenorhabditis elegans: coelomocyte uptake defective mutants." Genetics. 159(1):133-145. PMID:11560892
Plasma membrane Ca2+ ATPases (PMCAs) maintain proper intracellular Ca2+ levels by extruding Ca2+ from the cytosol. PMCA genes and splice forms are expressed in tissue-specific patterns in vertebrates, suggesting that these isoforms may regulate specific biological processes. However, knockout mutants die as embryos or undergo cell death; thus, it is unclear whether other cell processes utilize PMCAs or whether these pumps are largely committed to the control of toxic levels of calcium. Here, we analyze the role of the PMCA gene, mca-3, in Caenorhabditis elegans. We report that partial loss-of-function mutations disrupt clathrin-mediated endocytosis in a class of scavenger cells called coelomocytes. Moreover, components of early endocytic machinery are mislocalized in mca-3 mutants, including phosphatidylinositol-4,5-bisphosphate, clathrin and the Eps15 homology (EH) domain protein RME-1. This defect in endocytosis in the coelomocytes can be reversed by lowering calcium. Together, these data support a function for PMCAs in the regulation of endocytosis in the C. elegans coelomocytes. In addition, they suggest that endocytosis can be blocked by high calcium levels.
InterPro, an integrated documentation resource of protein families, domains and functional sites, was created in 1999 as a means of amalgamating the major protein signature databases into one comprehensive resource. PROSITE, Pfam, PRINTS, ProDom, SMART and TIGRFAMs have been manually integrated and curated and are available in InterPro for text- and sequence-based searching. The results are provided in a single format that rationalises the results that would be obtained by searching the member databases individually. The latest release of InterPro contains 5629 entries describing 4280 families, 1239 domains, 95 repeats and 15 post-translational modifications. Currently, the combined signatures in InterPro cover more than 74% of all proteins in SWISS-PROT and TrEMBL, an increase of nearly 15% since the inception of InterPro. New features of the database include improved searching capabilities and enhanced graphical user interfaces for visualisation of the data. The database is available via a webserver (http://www.ebi.ac.uk/interpro) and anonymous FTP (ftp://ftp.ebi.ac.uk/pub/databases/interpro).
A principal challenge currently facing biologists is how to connect the complete DNA sequence of an organism to its development and behaviour. Large-scale targeted-deletions have been successful in defining gene functions in the single-celled yeast Saccharomyces cerevisiae, but comparable analyses have yet to be performed in an animal. Here we describe the use of RNA interference to inhibit the function of approximately 86% of the 19,427 predicted genes of C. elegans. We identified mutant phenotypes for 1,722 genes, about two-thirds of which were not previously associated with a phenotype. We find that genes of similar functions are clustered in distinct, multi-megabase regions of individual chromosomes; genes in these regions tend to share transcriptional profiles. Our resulting data set and reusable RNAi library of 16,757 bacterial clones will facilitate systematic analyses of the connections among gene sequence, chromosomal location and gene function in C. elegans.
Gene Ontology Annotation (GOA) is a project run by the European Bioinformatics Institute (EBI) that aims to provide assignments of terms from the Gene Ontology (GO) resource to gene products in a number of its databases (http://www.ebi.ac.uk/GOA). In the first stage of this project, GO assignments have been applied to a data set representing the complete human proteome by a combination of electronic mappings and manual curation. This vocabulary has also been applied to the nonredundant proteome sets for all other completely sequenced organisms as well as to proteins from a wide range of organisms where the proteome is not yet complete.
RNA-mediated interference (RNAi) is a method to inhibit gene function by introduction of double-stranded RNA (dsRNA). Recently, an RNAi library was constructed that consists of bacterial clones expressing dsRNA, corresponding to nearly 90% of the 19,427 predicted genes of C. elegans. Feeding of this RNAi library to the standard wild-type laboratory strain Bristol N2 detected phenotypes for approximately 10% of the corresponding genes. To increase the number of genes for which a loss-of-function phenotype can be detected, we undertook a genome-wide RNAi screen using the rrf-3 mutant strain, which we found to be hypersensitive to RNAi. Feeding of the RNAi library to rrf-3 mutants resulted in additional loss-of-function phenotypes for 393 genes, increasing the number of genes with a phenotype by 23%. These additional phenotypes are distributed over different phenotypic classes. We also studied interexperimental variability in RNAi results and found persistent levels of false negatives. In addition, we used the RNAi phenotypes obtained with the genome-wide screens to systematically clone seven existing genetic mutants with visible phenotypes. The genome-wide RNAi screen using rrf-3 significantly increased the functional data on the C. elegans genome. The resulting dataset will be valuable in conjunction with other functional genomics approaches, as well as in other model organisms.
The coelomocytes of Caenorhabditis elegans are scavenger cells that continuously and nonspecifically endocytose fluid from the pseudocoelom (body cavity). Green fluorescent protein (GFP) secreted into the pseudocoelom from body wall muscle cells is endocytosed and degraded by coelomocytes. We show that toxin-mediated ablation of coelomocytes results in viable animals that fail to endocytose pseudocoelomic GFP, indicating that endocytosis by coelomocytes is not essential for growth or survival of C. elegans under normal laboratory conditions. We examined known viable endocytosis mutants, and performed RNAi for other known endocytosis genes, for coelomocyte uptake defective (Cup) phenotypes. We also screened for new genes involved in endocytosis by isolating viable mutants with Cup defects; this screen identified 14 different genes, many with multiple alleles. A variety of Cup terminal phenotypes were observed, consistent with defects at various steps in the endocytic pathway. Available molecular information indicates that the Cup mutant screen has identified novel components of the endocytosis machinery that are conserved in mammals but not in Saccharomyces cerevisiae, the only other organism for which large-scale genetic screens for endocytosis mutants have been performed.