acbp-5 | GeneID:176800 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 176800 Official Symbol acbp-5
Locus T12D8.3 Gene Type protein-coding
Synonyms
Full Name N/A
Description Acyl-Coenzyme A Binding Protein
Chromosome N/A
Also Known As Acyl-Coenzyme A Binding Protein family member (acbp-5)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 12465

ID Symbol Protein Species
GeneID:72482 Acbd6 NP_082526.1 Mus musculus
GeneID:84320 ACBD6 NP_115736.1 Homo sapiens
GeneID:176800 acbp-5 NP_499817.2 Caenorhabditis elegans
GeneID:289125 Acbd6 NP_001011906.1 Rattus norvegicus
GeneID:324090 acbd6 NP_001020626.1 Danio rerio
GeneID:424416 ACBD6 XP_422259.2 Gallus gallus
GeneID:469602 ACBD6 XP_524985.1 Pan troglodytes
GeneID:480029 ACBD6 XP_537152.2 Canis lupus familiaris
GeneID:618245 ACBD6 XP_875668.2 Bos taurus
GeneID:828891 ACBP2 NP_194507.1 Arabidopsis thaliana
GeneID:835428 ACBP1 NP_200159.1 Arabidopsis thaliana
GeneID:3771728 CG33713 NP_001027085.1 Drosophila melanogaster
GeneID:4337434 Os04g0681900 NP_001054292.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0000062 Function acyl-CoA binding
GO:0005488 Function binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_067416 NP_499817

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
T12D8.3 MI0000349 cel-miR-269 GGCAAGACUCUGGCAAAACU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_067416  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719