abcf-2 | GeneID:176771 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 176771 Official Symbol abcf-2
Locus T27E9.7 Gene Type protein-coding
Synonyms
Full Name N/A
Description ABC transporter, class F
Chromosome N/A
Also Known As ABC transporter, class F family member (abcf-2)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21408

ID Symbol Protein Species
GeneID:10061 ABCF2 NP_005683.2 Homo sapiens
GeneID:27407 Abcf2 NP_038881.1 Mus musculus
GeneID:32508 CG9281 NP_573057.1 Drosophila melanogaster
GeneID:176771 abcf-2 NP_499779.1 Caenorhabditis elegans
GeneID:311959 Abcf2 XP_231307.1 Rattus norvegicus
GeneID:336770 abcf2 NP_958472.1 Danio rerio
GeneID:426038 ABCF2 NP_001006562.1 Gallus gallus
GeneID:463887 ABCF2 XP_001139777.1 Pan troglodytes
GeneID:482806 ABCF2 XP_850220.1 Canis lupus familiaris
GeneID:513061 ABCF2 NP_001039601.1 Bos taurus
GeneID:836200 ATGCN1 NP_200887.1 Arabidopsis thaliana
GeneID:1273267 AgaP_AGAP002693 XP_312228.2 Anopheles gambiae
GeneID:4346343 Os08g0564100 NP_001062528.1 Oryza sativa
GeneID:4347924 Os09g0572400 NP_001063997.1 Oryza sativa
GeneID:100000576 LOC100000576 XP_001337123.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_067378 NP_499779

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
T27E9.7.1 MI0000008 cel-miR-37 UCACCGGGUGAACACUUGCAGU
T27E9.7.2 MI0000004 cel-miR-2 UAUCACAGCCAGCUUUGAUGUGC
T27E9.7.2 MI0000326 cel-miR-250 AAUCACAGUCAACUGUUGGCA
T27E9.7.2 MI0000008 cel-miR-37 UCACCGGGUGAACACUUGCAGU
T27E9.7.2 MI0000009 cel-miR-38 UCACCGGGAGAAAAACUGGAGU
T27E9.7.2 MI0005194 cel-miR-793 UGAGGUAUCUUAGUUAGACAGA
T27E9.7.2 MI0005198 cel-miR-797 UAUCACAGCAAUCACAAUGAGAAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_067378  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719