abce-1 | GeneID:176733 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 176733 Official Symbol abce-1
Locus Y39E4B.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description ABC transporter, class E
Chromosome N/A
Also Known As ABC transporter, class E family member (abce-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2205

ID Symbol Protein Species
GeneID:6059 ABCE1 NP_001035809.1 Homo sapiens
GeneID:24015 Abce1 NP_056566.2 Mus musculus
GeneID:39027 CG5651 NP_648272.1 Drosophila melanogaster
GeneID:176733 abce-1 NP_499717.1 Caenorhabditis elegans
GeneID:361390 Abce1 XP_001064797.1 Rattus norvegicus
GeneID:406324 abce1 NP_998216.1 Danio rerio
GeneID:422462 ABCE1 NP_001006440.1 Gallus gallus
GeneID:461523 ABCE1 XP_517465.1 Pan troglodytes
GeneID:475454 ABCE1 XP_532679.2 Canis lupus familiaris
GeneID:514991 ABCE1 XP_592921.3 Bos taurus
GeneID:813912 MAL13P1.344 XP_001350392.1 Plasmodium falciparum
GeneID:827661 ATRLI2 NP_193656.2 Arabidopsis thaliana
GeneID:851665 RLI1 NP_010376.1 Saccharomyces cerevisiae
GeneID:1269374 AgaP_AGAP002182 XP_308004.2 Anopheles gambiae
GeneID:2539753 SPBC14F5.06 NP_596732.1 Schizosaccharomyces pombe
GeneID:2677986 MGG_11382 XP_362155.2 Magnaporthe grisea
GeneID:2712409 NCU03061.1 XP_330497.1 Neurospora crassa
GeneID:2891913 KLLA0C17556g XP_452984.1 Kluyveromyces lactis
GeneID:4350692 Os11g0546000 NP_001068062.1 Oryza sativa
GeneID:4623093 AGOS_AGR125W NP_986791.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0009055 Function electron carrier activity
GO:0051536 Function iron-sulfur cluster binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0010171 Process body morphogenesis
GO:0009792 Process embryonic development ending in birth or egg hatching
GO:0040007 Process growth
GO:0040035 Process hermaphrodite genitalia development
GO:0040011 Process locomotion
GO:0002119 Process nematode larval development
GO:0040010 Process positive regulation of growth rate
GO:0000003 Process reproduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_067316 NP_499717

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
Y39E4B.1 MI0000026 cel-miR-55 UACCCGUAUAAGUUUCUGCUGAG
Y39E4B.1 MI0005184 cel-miR-784 UGGCACAAUCUGCGUACGUAGA
Y39E4B.1 MI0005191 cel-miR-790 CUUGGCACUCGCGAACACCGCG
Y39E4B.1 MI0005192 cel-miR-791 UUUGGCACUCCGCAGAUAAGGCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_067316  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ceron J, et al. (2007) "Large-scale RNAi screens identify novel genes that interact with the C. elegans retinoblastoma pathway as well as splicing-related components with synMuv B activity." BMC Dev Biol. 7():30. PMID:17417969
  2. [ + ] Sonnichsen B, et al. (2005) "Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans." Nature. 434(7032):462-469. PMID:15791247
  3. [ + ] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431
  4. [ + ] Zhao Z, et al. (2004) "ATP-binding cassette protein E is involved in gene transcription and translation in Caenorhabditis elegans." Biochem Biophys Res Commun. 323(1):104-111. PMID:15351708
  5. [ + ] Rual JF, et al. (2004) "Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library." Genome Res. 14(10B):2162-2168. PMID:15489339
  6. [ + ] Kamath RS, et al. (2003) "Systematic functional analysis of the Caenorhabditis elegans genome using RNAi." Nature. 421(6920):231-237. PMID:12529635
  7. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  8. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719
  9. [ + ] Simmer F, et al. (2003) "Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions." PLoS Biol. 1(1):E12. PMID:14551910
  10. [ + ] Gonczy P, et al. (2000) "Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III." Nature. 408(6810):331-336. PMID:11099034