4-NITROPHENYLPHOSPHATASE | GeneID:176232 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 176232 Official Symbol 4-NITROPHENYLPHOSPHATASE
Locus K02D10.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 119388

ID Symbol Protein Species
GeneID:176232 4-NITROPHENYLPHOSPHATASE NP_498939.3 Caenorhabditis elegans
GeneID:183469 C45E5.1 NP_500857.2 Caenorhabditis elegans

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001129235 NP_001122707
2 NM_066535 NP_498936
3 NM_066538 NP_498939

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
K02D10.1b.1 MI0000023 cel-miR-52 CACCCGUACAUAUGUUUCCGUGCU
K02D10.1b.1 MI0000044 cel-miR-73 UGGCAAGAUGUAGGCAGUUCAGU
K02D10.1b.2 MI0000023 cel-miR-52 CACCCGUACAUAUGUUUCCGUGCU
K02D10.1b.2 MI0000044 cel-miR-73 UGGCAAGAUGUAGGCAGUUCAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene