aak-1 | GeneID:176230 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 176230 Official Symbol aak-1
Locus PAR2.3 Gene Type protein-coding
Synonyms
Full Name N/A
Description AMP-Activated Kinase
Chromosome N/A
Also Known As AMP-Activated Kinase family member (aak-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 84992

ID Symbol Protein Species
GeneID:176230 aak-1 NP_741254.3 Caenorhabditis elegans
GeneID:833940 SnRK1.3 NP_198760.1 Arabidopsis thaliana

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0004672 Function protein kinase activity
GO:0004674 Function protein serine/threonine kinase activity
GO:0004713 Function protein tyrosine kinase activity
GO:0008285 Process negative regulation of cell proliferation
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_171216 NP_741254
2 NM_171217 NP_741255

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
PAR2.3a MI0000322 cel-miR-246 UUACAUGUUUCGGGUAGGAGC
PAR2.3a MI0000753 cel-miR-354 ACCUUGUUUGUUGCUGCUCCU
PAR2.3a MI0000007 cel-miR-36 UCACCGGGUGAAAAUUCGCAUG
PAR2.3a MI0000009 cel-miR-38 UCACCGGGAGAAAAACUGGAGU
PAR2.3a MI0000010 cel-miR-39 UCACCGGGUGUAAAUCAGCUUG
PAR2.3a MI0000011 cel-miR-40 UCACCGGGUGUACAUCAGCUAA
PAR2.3a MI0000013 cel-miR-42 UCACCGGGUUAACAUCUACAGA
PAR2.3b.2 MI0000322 cel-miR-246 UUACAUGUUUCGGGUAGGAGC
PAR2.3b.2 MI0000753 cel-miR-354 ACCUUGUUUGUUGCUGCUCCU
PAR2.3b.2 MI0000007 cel-miR-36 UCACCGGGUGAAAAUUCGCAUG
PAR2.3b.2 MI0000009 cel-miR-38 UCACCGGGAGAAAAACUGGAGU
PAR2.3b.2 MI0000010 cel-miR-39 UCACCGGGUGUAAAUCAGCUUG
PAR2.3b.2 MI0000011 cel-miR-40 UCACCGGGUGUACAUCAGCUAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719