let-754 | GeneID:176118 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 176118 Official Symbol let-754
Locus C29E4.8 Gene Type protein-coding
Synonyms
Full Name N/A
Description LEThal
Chromosome N/A
Also Known As LEThal family member (let-754)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1227

ID Symbol Protein Species
GeneID:204 AK2 NP_001616.1 Homo sapiens
GeneID:11637 Ak2 NP_001029138.1 Mus musculus
GeneID:24184 Ak2 NP_112248.1 Rattus norvegicus
GeneID:37834 Adk2 NP_523836.2 Drosophila melanogaster
GeneID:176118 let-754 NP_498730.1 Caenorhabditis elegans
GeneID:280716 AK2 NP_776314.1 Bos taurus
GeneID:321793 ak2 NP_997761.1 Danio rerio
GeneID:428227 AK2 XP_425786.2 Gallus gallus
GeneID:456723 AK2 XP_001165163.1 Pan troglodytes
GeneID:478145 AK2 XP_535321.2 Canis lupus familiaris
GeneID:810244 PF10_0086 XP_001347371.1 Plasmodium falciparum
GeneID:835104 AT5G50370 NP_199848.1 Arabidopsis thaliana
GeneID:836459 ADK1 NP_201145.1 Arabidopsis thaliana
GeneID:851812 ADK1 NP_010512.1 Saccharomyces cerevisiae
GeneID:1269521 AgaP_AGAP007722 XP_308155.2 Anopheles gambiae
GeneID:2542704 adk1 NP_593685.1 Schizosaccharomyces pombe
GeneID:2674388 MGG_01058 XP_368186.1 Magnaporthe grisea
GeneID:2709914 NCU01550.1 XP_327989.1 Neurospora crassa
GeneID:2896019 KLLA0F13376g XP_455682.1 Kluyveromyces lactis
GeneID:4350358 Os11g0312400 NP_001067759.1 Oryza sativa
GeneID:4351850 Os12g0236400 NP_001066462.1 Oryza sativa
GeneID:4623155 AGOS_AGR187W NP_986853.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0019205 Function nucleobase, nucleoside, nucleotide kinase activity
GO:0019201 Function nucleotide kinase activity
GO:0016776 Function phosphotransferase activity, phosphate group as acceptor
GO:0009792 Process embryonic development ending in birth or egg hatching
GO:0040007 Process growth
GO:0040035 Process hermaphrodite genitalia development
GO:0002119 Process nematode larval development
GO:0006139 Process nucleobase, nucleoside, nucleotide and nucleic acid metabolic process
GO:0040010 Process positive regulation of growth rate
GO:0040018 Process positive regulation of multicellular organism growth
GO:0035046 Process pronuclear migration
GO:0000003 Process reproduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_066329 NP_498730

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C29E4.8.1 MI0000020 cel-miR-49 AAGCACCACGAGAAGCUGCAGA
C29E4.8.2 MI0000311 cel-miR-236 UAAUACUGUCAGGUAAUGACGCU
C29E4.8.2 MI0000755 cel-miR-356 UUGAGCAACGCGAACAAAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_066329  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ceron J, et al. (2007) "Large-scale RNAi screens identify novel genes that interact with the C. elegans retinoblastoma pathway as well as splicing-related components with synMuv B activity." BMC Dev Biol. 7():30. PMID:17417969
  2. [ + ] Sonnichsen B, et al. (2005) "Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans." Nature. 434(7032):462-469. PMID:15791247
  3. [ + ] Rual JF, et al. (2004) "Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library." Genome Res. 14(10B):2162-2168. PMID:15489339
  4. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  5. [ + ] Kamath RS, et al. (2003) "Systematic functional analysis of the Caenorhabditis elegans genome using RNAi." Nature. 421(6920):231-237. PMID:12529635
  6. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719
  7. [ + ] Simmer F, et al. (2003) "Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions." PLoS Biol. 1(1):E12. PMID:14551910
  8. [ + ] Gonczy P, et al. (2000) "Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III." Nature. 408(6810):331-336. PMID:11099034