ACAN | GeneID:176 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 176 Official Symbol ACAN
Locus N/A Gene Type protein-coding
Synonyms AGC1; AGCAN; CSPG1; CSPGCP; MSK16; SEDK
Full Name aggrecan
Description aggrecan
Chromosome 15q26.1
Also Known As aggrecan 1 (chondroitin sulfate proteoglycan 1, large aggregating proteoglycan, antigen identified by monoclonal antibody A0122); aggrecan proteoglycan; cartilage-specific proteoglycan core protein; chondroitin sulfate proteoglycan 1; large aggregating proteoglycan
Summary This gene is a member of the aggrecan/versican proteoglycan family. The encoded protein is an integral part of the extracellular matrix in cartilagenous tissue and it withstands compression in cartilage. Mutations in this gene may be involved in skeletal dysplasia and spinal degeneration. Multiple alternatively spliced transcript variants that encode different protein isoforms have been observed in this gene. [provided by RefSeq]

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab53731 Aggrecan antibody - Cleaved Asp369 (ab53731); Rabbit polyclonal to Aggrecan - Cleaved Asp369
2 abcam ab36861 Aggrecan antibody (ab36861); Rabbit polyclonal to Aggrecan
3 abcam ab16320 Aggrecan antibody (ab16320); Rabbit polyclonal to Aggrecan
4 abcam ab3777 Aggrecan xxPEN antibody [BC-4] (ab3777); Mouse monoclonal [BC-4] to Aggrecan xxPEN
5 abcam ab3778 Aggrecan antibody [6-B-4] (ab3778); Mouse monoclonal [6-B-4] to Aggrecan
6 abcam ab3775 Aggrecan antibody [BC-13] (ab3775); Mouse monoclonal [BC-13] to Aggrecan
7 abcam ab179 Aggrecan antibody [HAG7E1] (ab179); Mouse monoclonal [HAG7E1] to Aggrecan
8 abcam ab22485 Aggrecan antibody [MA75A95 (HAG7E1)] (ab22485); Mouse monoclonal [MA75A95 (HAG7E1)] to Aggrecan
9 abcam ab3773 Aggrecan ARGxx antibody [BC-3] (ab3773); Mouse monoclonal [BC-3] to Aggrecan ARGxx
10 abcam ab3776 Aggrecan FFGxx antibody [BC-14] (ab3776); Mouse monoclonal [BC-14] to Aggrecan FFGxx
11 abnova MAB0327 ACAN monoclonal antibody, clone 8G4; Mouse monoclonal antibody raised against a native ACAN.
12 abnova MAB0328 ACAN monoclonal antibody, clone 2G5; Mouse monoclonal antibody raised against a native ACAN.
13 abnova MAB0329 ACAN monoclonal antibody, clone 5B11; Mouse monoclonal antibody raised against a native ACAN.
14 abnova MAB0330 ACAN monoclonal antibody, clone 4F4; Mouse monoclonal antibody raised against a native ACAN.
15 abnova MAB0331 ACAN monoclonal antibody, clone 5C5; Mouse monoclonal antibody raised against a native ACAN.
16 abnova MAB0332 ACAN monoclonal antibody, clone 5D3; Mouse monoclonal antibody raised against a native ACAN.
17 abnova MAB0333 ACAN monoclonal antibody, clone 5G2; Mouse monoclonal antibody raised against a native ACAN.
18 abnova MAB0334 ACAN monoclonal antibody, clone 5F12; Mouse monoclonal antibody raised against a native ACAN.
19 abnova MAB0335 ACAN monoclonal antibody, clone 5G5; Mouse monoclonal antibody raised against a native ACAN.
20 abnova MAB0336 ACAN monoclonal antibody, clone 3C7; Mouse monoclonal antibody raised against a native ACAN.
21 abnova MAB0337 ACAN monoclonal antibody, clone 7B7; Mouse monoclonal antibody raised against a native ACAN.
22 abnova MAB0338 ACAN monoclonal antibody, clone 7C9; Mouse monoclonal antibody raised against a native ACAN.
23 abnova H00000176-M01 AGC1 monoclonal antibody (M01), clone 2A8; Mouse monoclonal antibody raised against a partial recombinant AGC1.
24 abnova MAB0339 ACAN monoclonal antibody, clone 7D4; Mouse monoclonal antibody raised against a native ACAN.
25 abnova MAB0322 ACAN monoclonal antibody, clone 4F8; Mouse monoclonal antibody raised against a native ACAN.
26 abnova MAB0323 ACAN monoclonal antibody, clone 8E10; Mouse monoclonal antibody raised against a native ACAN.
27 abnova MAB0324 ACAN monoclonal antibody, clone 7E1; Mouse monoclonal antibody raised against a native ACAN.
28 abnova MAB0325 ACAN monoclonal antibody, clone 6F4; Mouse monoclonal antibody raised against a native ACAN.
29 abnova MAB0326 ACAN monoclonal antibody, clone 6E5; Mouse monoclonal antibody raised against a native ACAN.
30 scbt ACAN ACAN Antibody / ACAN Antibodies;
31 sigma C8035 Monoclonal Anti-Chondroitin Sulfate antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACAN Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACAN Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0005578 Component proteinaceous extracellular matrix
GO:0005488 Function binding
GO:0030021 Function extracellular matrix structural constituent conferring compression resistance
GO:0005540 Function hyaluronic acid binding
GO:0005529 Function sugar binding
GO:0007155 Process cell adhesion
GO:0030198 Process extracellular matrix organization
GO:0006508 Process proteolysis
GO:0001501 Process skeletal system development

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001135  UCSC Browser NP_001126
2 NM_013227  UCSC Browser NP_037359

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000268134 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000268134 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000268134 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000268134 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000268134 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENST00000268134 MI0000074 hsa-miR-19b-1* AGUUUUGCAGGUUUGCAUCCAGC
ENST00000268134 MI0000075 hsa-miR-19b-2* AGUUUUGCAGGUUUGCAUUUCA
ENST00000268134 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000268134 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000268134 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000268134 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000268134 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000268134 MI0000760 hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU
ENST00000268134 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000268134 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000268134 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000268134 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000268134 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENST00000268134 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENST00000268134 MI0005561 hsa-miR-877* UCCUCUUCUCCCUCCUCCCAG
ENST00000268134 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000268134 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000268134 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000268134 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENST00000268134 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000268134 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000268134 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENST00000268134 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA
ENST00000268134 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AK290723   BC036445   BC150624   BQ182050   BQ446640   DA596050   J05062   M55172   NM_001135   NM_013227   U13192   X17406   X80278  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acrylamide
  • Acrylamide results in decreased expression of ACAN mRNA
16876394
Ethanol
  • Ethanol results in decreased expression of ACAN mRNA
17920746
Tretinoin
  • Tretinoin results in decreased expression of ACAN mRNA
16410076

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Muscular Dystrophy, Facioscapulohumeral marker 12868502
SPONDYLOEPIPHYSEAL DYSPLASIA, KIMBERLEY TYPE marker
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 16935935, 15748426, 12679006, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Burns inferred via Ethanol 16374292
Carcinoma, Hepatocellular inferred via Ethanol 15763234, 15289165
Esophageal Neoplasms inferred via Ethanol 16704527
Fatty Liver inferred via Ethanol 16409862
Fatty Liver, Alcoholic inferred via Ethanol 17920746
Fetal Alcohol Syndrome inferred via Ethanol 16946407
Hepatitis, Toxic inferred via Ethanol 11566570
Liver Cirrhosis inferred via Ethanol 15289165
Liver Cirrhosis, Alcoholic inferred via Ethanol 18295389
Liver Cirrhosis, Experimental inferred via Ethanol 18166357
Liver Diseases, Alcoholic inferred via Ethanol 17207112, 17347304
Breast Neoplasms inferred via Acrylamide 16253758, 18183576
Cattle Diseases inferred via Acrylamide 12510666
Infertility, Female inferred via Acrylamide 11020651
Infertility, Male inferred via Acrylamide 15749267, 11020651, 12507653, 15355880
Nerve Degeneration inferred via Acrylamide 11264303, 12387367, 12387366
Nervous System Diseases inferred via Acrylamide 12164553, 12507653
Peripheral Nervous System Diseases inferred via Acrylamide 11510240
Testicular Diseases inferred via Acrylamide 15864552

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Martins-de-Souza D, et al. (2009) "Alterations in oligodendrocyte proteins, calcium homeostasis and new potential markers in schizophrenia anterior temporal lobe are revealed by shotgun proteome analysis." J Neural Transm. 116(3):275-289. PMID:19034380
  2. [ + ] Muramatsu K, et al. (2009) "Ultrastructural immunolocalization of a cartilage-specific proteoglycan, aggrecan, in salivary pleomorphic adenomas." Med Mol Morphol. 42(1):47-54. PMID:19294492
  3. [ + ] Sovio U, et al. (2009) "Genetic determinants of height growth assessed longitudinally from infancy to adulthood in the northern Finland birth cohort 1966." PLoS Genet. 5(3):e1000409. PMID:19266077
  4. [ + ] Videman T, et al. (2009) "Associations of 25 structural, degradative, and inflammatory candidate genes with lumbar disc desiccation, bulging, and height narrowing." Arthritis Rheum. 60(2):470-481. PMID:19180518
  5. [ + ] Tompson SW, et al. (2009) "A recessive skeletal dysplasia, SEMD aggrecan type, results from a missense mutation affecting the C-type lectin domain of aggrecan." Am J Hum Genet. 84(1):72-79. PMID:19110214
  6. [ + ] Weedon MN, et al. (2008) "Genome-wide association analysis identifies 20 loci that influence adult height." Nat Genet. 40(5):575-583. PMID:18391952
  7. [ + ] De Souza TB, et al. (2008) "Association Between the Aggrecan Gene and Rheumatoid Arthritis." J Rheumatol. 35(12):2325-2328. PMID:19004047
  8. [ + ] Bruckner G, et al. (2008) "Aggrecan-based extracellular matrix is an integral part of the human basal ganglia circuit." Neuroscience. 151(2):489-504. PMID:18055126
  9. [ + ] Maehara H, et al. (2007) "G1-G2 aggrecan product that can be generated by M-calpain on truncation at Ala709-Ala710 is present abundantly in human articular cartilage." J Biochem. 141(4):469-477. PMID:17261541
  10. [ + ] Miyamoto C, et al. (2007) "Osteogenic protein-1 with transforming growth factor-beta1: potent inducer of chondrogenesis of synovial mesenchymal stem cells in vitro." J Orthop Sci. 12(6):555-561. PMID:18040638
  11. [ + ] Solovieva S, et al. (2007) "Association between the aggrecan gene variable number of tandem repeats polymorphism and intervertebral disc degeneration." Spine. 32(16):1700-1705. PMID:17632389
  12. [ + ] Chen FH, et al. (2007) "Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan." J Biol Chem. 282(34):24591-24598. PMID:17588949
  13. [ + ] Wuertz K, et al. (2007) "Influence of extracellular osmolarity and mechanical stimulation on gene expression of intervertebral disc cells." J Orthop Res. 25(11):1513-1522. PMID:17568421
  14. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  15. [ + ] Marosy B, et al. (2006) "Lack of association between the aggrecan gene and familial idiopathic scoliosis." Spine. 31(13):1420-1425. PMID:16741449
  16. [ + ] Lemire JM, et al. (2006) "Aggrecan expression is substantially and abnormally upregulated in Hutchinson-Gilford Progeria Syndrome dermal fibroblasts." Mech Ageing Dev. 127(8):660-669. PMID:16650460
  17. [ + ] Skandalis SS, et al. (2006) "Cartilage aggrecan undergoes significant compositional and structural alterations during laryngeal cancer." Biochim Biophys Acta. 1760(7):1046-1053. PMID:16574327
  18. [ + ] Sivan SS, et al. (2006) "Aggrecan turnover in human intervertebral disc as determined by the racemization of aspartic acid." J Biol Chem. 281(19):13009-13014. PMID:16537531
  19. [ + ] Roughley P, et al. (2006) "The involvement of aggrecan polymorphism in degeneration of human intervertebral disc and articular cartilage." Eur Cell Mater. 11():1-7; discussion 7. PMID:16425147
  20. [ + ] Nobuhara Y, et al. (2006) "Genetic variability in the extracellular matrix protein as a determinant of risk for developing HTLV-I-associated neurological disease." Immunogenetics. 57(12):944-952. PMID:16402214
  21. [ + ] Preradovic A, et al. (2005) "Quantitation of collagen I, collagen II and aggrecan mRNA and expression of the corresponding proteins in human nucleus pulposus cells in monolayer cultures." Cell Tissue Res. 321(3):459-464. PMID:16001263
  22. [ + ] Liu T, et al. (2005) "Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry." J Proteome Res. 4(6):2070-2080. PMID:16335952
  23. [ + ] Gleghorn L, et al. (2005) "A mutation in the variable repeat region of the aggrecan gene (AGC1) causes a form of spondyloepiphyseal dysplasia associated with severe, premature osteoarthritis." Am J Hum Genet. 77(3):484-490. PMID:16080123
  24. [ + ] Seyfried NT, et al. (2005) "Expression and purification of functionally active hyaluronan-binding domains from human cartilage link protein, aggrecan and versican: formation of ternary complexes with defined hyaluronan oligosaccharides." J Biol Chem. 280(7):5435-5448. PMID:15590670
  25. [ + ] Shi S, et al. (2004) "Link protein has greater affinity for versican than aggrecan." J Biol Chem. 279(13):12060-12066. PMID:14724283
  26. [ + ] Dunlevy JR, et al. (2004) "Interaction of lumican with aggrecan in the aging human sclera." Invest Ophthalmol Vis Sci. 45(11):3849-3856. PMID:15505028
  27. [ + ] Day JM, et al. (2004) "Alternative splicing in the aggrecan G3 domain influences binding interactions with tenascin-C and other extracellular matrix proteins." J Biol Chem. 279(13):12511-12518. PMID:14722076
  28. [ + ] Hanyecz A, et al. (2003) "Induction of arthritis in SCID mice by T cells specific for the "shared epitope" sequence in the G3 domain of human cartilage proteoglycan." Arthritis Rheum. 48(10):2959-2973. PMID:14558103
  29. [ + ] Matsumoto K, et al. (2003) "Distinct interaction of versican/PG-M with hyaluronan and link protein." J Biol Chem. 278(42):41205-41212. PMID:12888576
  30. [ + ] Yamane T, et al. (2003) "Clinical correlations of aggrecan in the resected medial rectus muscle of patients with intermittent exotropia." Acta Med Okayama. 57(4):199-204. PMID:14627072
  31. [ + ] Rodriguez-Manzaneque JC, et al. (2002) "ADAMTS1 cleaves aggrecan at multiple sites and is differentially inhibited by metalloproteinase inhibitors." Biochem Biophys Res Commun. 293(1):501-508. PMID:12054629
  32. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  33. [ + ] Eyre S, et al. (2002) "Identification of a locus for a form of spondyloepiphyseal dysplasia on chromosome 15q26.1: exclusion of aggrecan as a candidate gene." J Med Genet. 39(9):634-638. PMID:12205105
  34. [ + ] Westling J, et al. (2002) "ADAMTS4 cleaves at the aggrecanase site (Glu373-Ala374) and secondarily at the matrix metalloproteinase site (Asn341-Phe342) in the aggrecan interglobular domain." J Biol Chem. 277(18):16059-16066. PMID:11854269
  35. [ + ] Lee V, et al. (2002) "Cleavage of the carboxyl tail from the G3 domain of aggrecan but not versican and identification of the amino acids involved in the degradation." J Biol Chem. 277(25):22279-22288. PMID:11932252
  36. [ + ] Zorkol'tseva IV, et al. (2002) "[Analysis of polymorphism of the number of tandem repeats in the aggrecan gene exon G3 in the families with idiopathic scoliosis]" Genetika. 38(2):259-263. PMID:11898616
  37. [ + ] Olin AI, et al. (2001) "The proteoglycans aggrecan and Versican form networks with fibulin-2 through their lectin domain binding." J Biol Chem. 276(2):1253-1261. PMID:11038354
  38. [ + ] Stracke JO, et al. (2000) "Matrix metalloproteinases 19 and 20 cleave aggrecan and cartilage oligomeric matrix protein (COMP)." FEBS Lett. 478(1-2):52-56. PMID:10922468
  39. [ + ] Aspberg A, et al. (1999) "Fibulin-1 is a ligand for the C-type lectin domains of aggrecan and versican." J Biol Chem. 274(29):20444-20449. PMID:10400671
  40. [ + ] Parkar AA, et al. (1998) "TSG-6 interacts with hyaluronan and aggrecan in a pH-dependent manner via a common functional element: implications for its regulation in inflamed cartilage." FEBS Lett. 428(3):171-176. PMID:9654129
  41. [ + ] Watanabe H, et al. (1998) "Roles of aggrecan, a large chondroitin sulfate proteoglycan, in cartilage structure and function." J Biochem. 124(4):687-693. PMID:9756610
  42. [ + ] Fosang AJ, et al. (1998) "Membrane-type 1 MMP (MMP-14) cleaves at three sites in the aggrecan interglobular domain." FEBS Lett. 430(3):186-190. PMID:9688535
  43. [ + ] Kirschfink M, et al. (1997) "Secreted chondroitin sulfate proteoglycan of human B cell lines binds to the complement protein C1q and inhibits complex formation of C1." J Immunol. 158(3):1324-1331. PMID:9013976
  44. [ + ] Fulop C, et al. (1996) "Species-specific alternative splicing of the epidermal growth factor-like domain 1 of cartilage aggrecan." Biochem J. 319 ( Pt 3)():935-940. PMID:8921002
  45. [ + ] Dudhia J, et al. (1996) "Age-related changes in the content of the C-terminal region of aggrecan in human articular cartilage." Biochem J. 313 ( Pt 3)():933-940. PMID:8611178
  46. [ + ] Ilic MZ, et al. (1995) "Catabolism of aggrecan by explant cultures of human articular cartilage in the presence of retinoic acid." Arch Biochem Biophys. 322(1):22-30. PMID:7574678
  47. [ + ] Valhmu WB, et al. (1995) "Structure of the human aggrecan gene: exon-intron organization and association with the protein domains." Biochem J. 309 ( Pt 2)():535-542. PMID:7626017
  48. [ + ] Fosang AJ, et al. (1994) "Neutrophil collagenase (MMP-8) cleaves at the aggrecanase site E373-A374 in the interglobular domain of cartilage aggrecan." Biochem J. 304 ( Pt 2)():347-351. PMID:7998967
  49. [ + ] Barry FP, et al. (1994) "Length variation in the keratan sulfate domain of mammalian aggrecan." Matrix Biol. 14(4):323-328. PMID:7827755
  50. [ + ] Glumoff V, et al. (1994) "Analysis of aggrecan and tenascin gene expression in mouse skeletal tissues by northern and in situ hybridization using species specific cDNA probes." Biochim Biophys Acta. 1219(3):613-622. PMID:7524681