abi-1 | GeneID:175789 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 175789 Official Symbol abi-1
Locus B0336.6 Gene Type protein-coding
Synonyms
Full Name N/A
Description ABl Interactor homolog
Chromosome N/A
Also Known As ABl Interactor homolog family member (abi-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4209

ID Symbol Protein Species
GeneID:10152 ABI2 NP_005750.4 Homo sapiens
GeneID:41718 Abi NP_001097785.1 Drosophila melanogaster
GeneID:175789 abi-1 NP_498224.1 Caenorhabditis elegans
GeneID:286928 Abi2 NP_775166.1 Rattus norvegicus
GeneID:329165 Abi2 NP_937760.1 Mus musculus
GeneID:424108 ABI2 XP_001232729.1 Gallus gallus
GeneID:459892 ABI2 XP_001173251.1 Pan troglodytes
GeneID:692331 zgc:136560 NP_001038762.1 Danio rerio
GeneID:1278655 AgaP_AGAP001046 XP_318274.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030424 Component axon
GO:0043025 Component cell soma
GO:0005737 Component cytoplasm
GO:0030425 Component dendrite
GO:0005515 Function protein binding
GO:0047485 Function protein N-terminus binding
GO:0010171 Process body morphogenesis
GO:0008340 Process determination of adult life span
GO:0009792 Process embryonic development ending in birth or egg hatching
GO:0040007 Process growth
GO:0040035 Process hermaphrodite genitalia development
GO:0040011 Process locomotion
GO:0002009 Process morphogenesis of an epithelium
GO:0002119 Process nematode larval development
GO:0001764 Process neuron migration
GO:0018991 Process oviposition
GO:0040010 Process positive regulation of growth rate
GO:0000003 Process reproduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_065823 NP_498224

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
B0336.6.1 MI0000001 cel-let-7 UGAGGUAGUAGGUUGUAUAGUU
B0336.6.2 MI0000001 cel-let-7 UGAGGUAGUAGGUUGUAUAGUU
B0336.6.2 MI0000327 cel-miR-251 UUAAGUAGUGGUGCCGCUCUUAUU
B0336.6.2 MI0000328 cel-miR-252 AUAAGUAGUAGUGCCGCAGGUAA
B0336.6.2 MI0000336 cel-miR-259 AAAUCUCAUCCUAAUCUGGUAGCA
B0336.6.2 MI0000005 cel-miR-34 AGGCAGUGUGGUUAGCUGGUUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_065823  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ceron J, et al. (2007) "Large-scale RNAi screens identify novel genes that interact with the C. elegans retinoblastoma pathway as well as splicing-related components with synMuv B activity." BMC Dev Biol. 7():30. PMID:17417969
  2. [ + ] Lehner B, et al. (2006) "Systematic mapping of genetic interactions in Caenorhabditis elegans identifies common modifiers of diverse signaling pathways." Nat Genet. 38(8):896-903. PMID:16845399
  3. [ + ] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431
  4. [ + ] Rual JF, et al. (2004) "Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library." Genome Res. 14(10B):2162-2168. PMID:15489339
  5. [ + ] Croce A, et al. (2004) "A novel actin barbed-end-capping activity in EPS-8 regulates apical morphogenesis in intestinal cells of Caenorhabditis elegans." Nat Cell Biol. 6(12):1173-1179. PMID:15558032
  6. [ + ] Kamath RS, et al. (2003) "Systematic functional analysis of the Caenorhabditis elegans genome using RNAi." Nature. 421(6920):231-237. PMID:12529635
  7. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  8. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719
  9. [ + ] Simmer F, et al. (2003) "Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions." PLoS Biol. 1(1):E12. PMID:14551910
  10. [ + ] Piano F, et al. (2002) "Gene clustering based on RNAi phenotypes of ovary-enriched genes in C. elegans." Curr Biol. 12(22):1959-1964. PMID:12445391