abts-3 | GeneID:174024 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 174024 Official Symbol abts-3
Locus F57F10.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description Anion/Bicarbonate TranSporter family
Chromosome N/A
Also Known As Anion/Bicarbonate TranSporter family member (abts-3)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 12931

ID Symbol Protein Species
GeneID:83959 SLC4A11 NP_114423.1 Homo sapiens
GeneID:174024 abts-3 NP_495228.1 Caenorhabditis elegans
GeneID:269356 Slc4a11 NP_001074631.1 Mus musculus
GeneID:311423 Slc4a11 XP_230605.4 Rattus norvegicus
GeneID:422943 SLC4A11 XP_420881.2 Gallus gallus
GeneID:458058 SLC4A11 XP_514482.2 Pan troglodytes
GeneID:485796 SLC4A11 XP_542919.2 Canis lupus familiaris
GeneID:559346 LOC559346 XP_001921077.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0015380 Function anion exchanger activity
GO:0005452 Function inorganic anion exchanger activity
GO:0006820 Process anion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001038244 NP_001033333
2 NM_062827 NP_495228
3 NM_182218 NP_872018

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F57F10.1a MI0000317 cel-miR-241 UGAGGUAGGUGCGAGAAAUGA
F57F10.1a MI0000339 cel-miR-262 GUUUCUCGAUGUUUUCUGAU
F57F10.1a MI0000022 cel-miR-51 UACCCGUAGCUCCUAUCCAUGUU
F57F10.1a MI0000023 cel-miR-52 CACCCGUACAUAUGUUUCCGUGCU
F57F10.1a MI0000024 cel-miR-53 CACCCGUACAUUUGUUUCCGUGCU
F57F10.1a MI0000025 cel-miR-54 UACCCGUAAUCUUCAUAAUCCGAG
F57F10.1a MI0000026 cel-miR-55 UACCCGUAUAAGUUUCUGCUGAG
F57F10.1a MI0000027 cel-miR-56 UACCCGUAAUGUUUCCGCUGAG
F57F10.1a MI0005196 cel-miR-795 UGAGGUAGAUUGAUCAGCGAGCUU
F57F10.1b MI0000317 cel-miR-241 UGAGGUAGGUGCGAGAAAUGA
F57F10.1b MI0000339 cel-miR-262 GUUUCUCGAUGUUUUCUGAU
F57F10.1b MI0000022 cel-miR-51 UACCCGUAGCUCCUAUCCAUGUU
F57F10.1b MI0000023 cel-miR-52 CACCCGUACAUAUGUUUCCGUGCU
F57F10.1b MI0000024 cel-miR-53 CACCCGUACAUUUGUUUCCGUGCU
F57F10.1b MI0000025 cel-miR-54 UACCCGUAAUCUUCAUAAUCCGAG
F57F10.1b MI0000026 cel-miR-55 UACCCGUAUAAGUUUCUGCUGAG
F57F10.1b MI0000027 cel-miR-56 UACCCGUAAUGUUUCCGCUGAG
F57F10.1b MI0005196 cel-miR-795 UGAGGUAGAUUGAUCAGCGAGCUU
F57F10.1c MI0000317 cel-miR-241 UGAGGUAGGUGCGAGAAAUGA
F57F10.1c MI0000339 cel-miR-262 GUUUCUCGAUGUUUUCUGAU
F57F10.1c MI0000022 cel-miR-51 UACCCGUAGCUCCUAUCCAUGUU
F57F10.1c MI0000023 cel-miR-52 CACCCGUACAUAUGUUUCCGUGCU
F57F10.1c MI0000024 cel-miR-53 CACCCGUACAUUUGUUUCCGUGCU
F57F10.1c MI0000025 cel-miR-54 UACCCGUAAUCUUCAUAAUCCGAG
F57F10.1c MI0000026 cel-miR-55 UACCCGUAUAAGUUUCUGCUGAG
F57F10.1c MI0000027 cel-miR-56 UACCCGUAAUGUUUCCGCUGAG
F57F10.1c MI0005196 cel-miR-795 UGAGGUAGAUUGAUCAGCGAGCUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719