acdh-1 | GeneID:172358 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 172358 Official Symbol acdh-1
Locus C55B7.4 Gene Type protein-coding
Synonyms
Full Name N/A
Description Acyl CoA DeHydrogenase
Chromosome N/A
Also Known As Acyl CoA DeHydrogenase family member (acdh-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1216

ID Symbol Protein Species
GeneID:36 ACADSB NP_001600.1 Homo sapiens
GeneID:25618 Acadsb NP_037216.1 Rattus norvegicus
GeneID:40059 CG3902 NP_649069.2 Drosophila melanogaster
GeneID:66885 Acadsb NP_080102.1 Mus musculus
GeneID:172351 K06A5.6 NP_491859.1 Caenorhabditis elegans
GeneID:172358 acdh-1 NP_491871.1 Caenorhabditis elegans
GeneID:423947 RCJMB04_12m17 NP_001026411.1 Gallus gallus
GeneID:477856 ACADSB XP_535048.2 Canis lupus familiaris
GeneID:504301 ACADSB NP_001017933.1 Bos taurus
GeneID:745464 ACADSB XP_001151318.1 Pan troglodytes
GeneID:1279196 AgaP_AGAP009783 XP_318878.2 Anopheles gambiae
GeneID:2679063 MGG_08690 XP_363106.2 Magnaporthe grisea
GeneID:2708357 NCU06543.1 XP_326398.1 Neurospora crassa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0016491 Function oxidoreductase activity
GO:0016627 Function oxidoreductase activity, acting on the CH-CH group of donors
GO:0006952 Process defense response
GO:0008340 Process determination of adult life span
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_059470 NP_491871
2 NM_181994 NP_871794

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C55B7.4a MI0000033 cel-miR-62 UGAUAUGUAAUCUAGCUUACAG
C55B7.4a MI0000041 cel-miR-70 UAAUACGUCGUUGGUGUUUCCAU
C55B7.4b.1 MI0000007 cel-miR-36 UCACCGGGUGAAAAUUCGCAUG
C55B7.4b.1 MI0000013 cel-miR-42 UCACCGGGUUAACAUCUACAGA
C55B7.4b.1 MI0000041 cel-miR-70 UAAUACGUCGUUGGUGUUUCCAU
C55B7.4b.2 MI0000329 cel-miR-253 UUAGUAGGCGUUGUGGGAAGG
C55B7.4b.2 MI0000007 cel-miR-36 UCACCGGGUGAAAAUUCGCAUG
C55B7.4b.2 MI0000013 cel-miR-42 UCACCGGGUUAACAUCUACAGA
C55B7.4b.5 MI0000313 cel-miR-238 UUUGUACUCCGAUGCCAUUCAGA
C55B7.4b.5 MI0000329 cel-miR-253 UUAGUAGGCGUUGUGGGAAGG
C55B7.4b.5 MI0000007 cel-miR-36 UCACCGGGUGAAAAUUCGCAUG
C55B7.4b.5 MI0000013 cel-miR-42 UCACCGGGUUAACAUCUACAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
gei-4 gei-4 / acdh-1 Two-hybrid Li S (2004)
mat-3 mat-3 / acdh-1 Two-hybrid Li S (2004)
N/A N/A / acdh-1 Two-hybrid Li S (2004)
paramyosin acdh-1 / paramyosin Two-hybrid Li S (2004)
tir-1 tir-1 / acdh-1 Two-hybrid Li S (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Shapira M, et al. (2006) "A conserved role for a GATA transcription factor in regulating epithelial innate immune responses." Proc Natl Acad Sci U S A. 103(38):14086-14091. PMID:16968778
  2. [ + ] Li S, et al. (2004) "A map of the interactome network of the metazoan C. elegans." Science. 303(5657):540-543. PMID:14704431
  3. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  4. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719
  5. [ + ] Murphy CT, et al. (2003) "Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans." Nature. 424(6946):277-283. PMID:12845331