acbp-1 | GeneID:172071 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 172071 Official Symbol acbp-1
Locus C44E4.6 Gene Type protein-coding
Synonyms
Full Name N/A
Description Acyl-Coenzyme A Binding Protein
Chromosome N/A
Also Known As Acyl-Coenzyme A Binding Protein family member (acbp-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 39086

ID Symbol Protein Species
GeneID:1622 DBI NP_065438.1 Homo sapiens
GeneID:13167 Dbi NP_001033088.1 Mus musculus
GeneID:25045 Dbi NP_114054.1 Rattus norvegicus
GeneID:38784 Dbi NP_523952.2 Drosophila melanogaster
GeneID:172071 acbp-1 NP_491412.1 Caenorhabditis elegans
GeneID:393831 zgc:77734 NP_955902.1 Danio rerio
GeneID:395263 DBI NP_989907.1 Gallus gallus
GeneID:459574 DBI XP_001156427.1 Pan troglodytes
GeneID:476115 DBI XP_849337.1 Canis lupus familiaris
GeneID:768330 DBI XP_869302.1 Bos taurus
GeneID:852925 ACB1 NP_011551.1 Saccharomyces cerevisiae
GeneID:1269756 AgaP_AGAP007460 XP_308405.2 Anopheles gambiae
GeneID:2539982 SPBC1539.06 NP_596820.1 Schizosaccharomyces pombe
GeneID:4619336 AGOS_ACL188W NP_983216.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0000062 Function acyl-CoA binding
GO:0005488 Function binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_059011 NP_491412

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C44E4.6.1 MI0000004 cel-miR-2 UAUCACAGCCAGCUUUGAUGUGC
C44E4.6.1 MI0005198 cel-miR-797 UAUCACAGCAAUCACAAUGAGAAGA
C44E4.6.2 MI0000004 cel-miR-2 UAUCACAGCCAGCUUUGAUGUGC
C44E4.6.2 MI0005198 cel-miR-797 UAUCACAGCAAUCACAAUGAGAAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_059011  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAB54171   NP_491412   O01805   T30954  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719