ars-2 | GeneID:171985 | Caenorhabditis elegans
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 171985 | Official Symbol | ars-2 |
|---|---|---|---|
| Locus | F28H1.3 | Gene Type | protein-coding |
| Synonyms | |||
| Full Name | N/A | ||
| Description | Alanyl tRNA Synthetase | ||
| Chromosome | N/A | ||
| Also Known As | Alanyl tRNA Synthetase family member (ars-2) | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 1213
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:16 | AARS | NP_001596.2 | Homo sapiens |
| GeneID:34156 | Aats-ala | NP_523511.2 | Drosophila melanogaster |
| GeneID:171985 | ars-2 | NP_491281.1 | Caenorhabditis elegans |
| GeneID:234734 | Aars | NP_666329.2 | Mus musculus |
| GeneID:292023 | Aars | XP_214690.3 | Rattus norvegicus |
| GeneID:324940 | aars | NP_001037775.1 | Danio rerio |
| GeneID:415668 | AARS | NP_001005836.1 | Gallus gallus |
| GeneID:454210 | AARS | XP_001169474.1 | Pan troglodytes |
| GeneID:479656 | AARS | XP_536788.2 | Canis lupus familiaris |
| GeneID:510933 | AARS | XP_588170.3 | Bos taurus |
| GeneID:814313 | PF13_0354 | XP_001350388.1 | Plasmodium falciparum |
| GeneID:841442 | ALATS | NP_175439.2 | Arabidopsis thaliana |
| GeneID:854513 | ALA1 | NP_014980.1 | Saccharomyces cerevisiae |
| GeneID:1279087 | AgaP_AGAP009701 | XP_318757.2 | Anopheles gambiae |
| GeneID:2542031 | SPAC23C11.09 | NP_593640.1 | Schizosaccharomyces pombe |
| GeneID:2676649 | MGG_03607 | XP_361064.2 | Magnaporthe grisea |
| GeneID:2713811 | NCU02566.1 | XP_331765.1 | Neurospora crassa |
| GeneID:2894909 | KLLA0F02431g | XP_455190.1 | Kluyveromyces lactis |
| GeneID:4348211 | Os10g0182000 | NP_001064254.1 | Oryza sativa |
| GeneID:4620624 | AGOS_ADR363C | NP_984459.1 | Eremothecium gossypii |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0004813 | Function | alanine-tRNA ligase activity |
| GO:0005524 | Function | ATP binding |
| GO:0016876 | Function | ligase activity, forming aminoacyl-tRNA and related compounds |
| GO:0003676 | Function | nucleic acid binding |
| GO:0000166 | Function | nucleotide binding |
| GO:0006419 | Process | alanyl-tRNA aminoacylation |
| GO:0009792 | Process | embryonic development ending in birth or egg hatching |
| GO:0040007 | Process | growth |
| GO:0040011 | Process | locomotion |
| GO:0002119 | Process | nematode larval development |
| GO:0040010 | Process | positive regulation of growth rate |
| GO:0000003 | Process | reproduction |
| GO:0006412 | Process | translation |
| GO:0043039 | Process | tRNA aminoacylation |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| F28H1.3.1 | MI0000333 | cel-miR-256 | UGGAAUGCAUAGAAGACUGUA |
| F28H1.3.3 | MI0000318 | cel-miR-242 | UUGCGUAGGCCUUUGCUUCGA |
| F28H1.3.3 | MI0000333 | cel-miR-256 | UGGAAUGCAUAGAAGACUGUA |
| F28H1.3.3 | MI0005193 | cel-miR-792 | UUGAAAUCUCUUCAACUUUCAGA |
| F28H1.3.3 | MI0005200 | cel-miR-799 | UGAACCCUGAUAAAGCUAGUGG |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Sonnichsen B, et al. (2005) "Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans." Nature. 434(7032):462-469. PMID:15791247 - [
] Rual JF, et al. (2004) "Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library." Genome Res. 14(10B):2162-2168. PMID:15489339 - [
] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011 - [
] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719 - [
] Simmer F, et al. (2003) "Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions." PLoS Biol. 1(1):E12. PMID:14551910 - [
] Fraser AG, et al. (2000) "Functional genomic analysis of C. elegans chromosome I by systematic RNA interference." Nature. 408(6810):325-330. PMID:11099033
A key challenge of functional genomics today is to generate well-annotated data sets that can be interpreted across different platforms and technologies. Large-scale functional genomics data often fail to connect to standard experimental approaches of gene characterization in individual laboratories. Furthermore, a lack of universal annotation standards for phenotypic data sets makes it difficult to compare different screening approaches. Here we address this problem in a screen designed to identify all genes required for the first two rounds of cell division in the Caenorhabditis elegans embryo. We used RNA-mediated interference to target 98% of all genes predicted in the C. elegans genome in combination with differential interference contrast time-lapse microscopy. Through systematic annotation of the resulting movies, we developed a phenotypic profiling system, which shows high correlation with cellular processes and biochemical pathways, thus enabling us to predict new functions for previously uncharacterized genes.
The recently completed Caenorhabditis elegans genome sequence allows application of high-throughput (HT) approaches for phenotypic analyses using RNA interference (RNAi). As large phenotypic data sets become available, "phenoclustering" strategies can be used to begin understanding the complex molecular networks involved in development and other biological processes. The current HT-RNAi resources represent a great asset for phenotypic profiling but are limited by lack of flexibility. For instance, existing resources do not take advantage of the latest improvements in RNAi technology, such as inducible hairpin RNAi. Here we show that a C. elegans ORFeome resource, generated with the Gateway cloning system, can be used as a starting point to generate alternative HT-RNAi resources with enhanced flexibility. The versatility inherent to the Gateway system suggests that additional HT-RNAi libraries can now be readily generated to perform gene knockdowns under various conditions, increasing the possibilities for phenome mapping in C. elegans.
InterPro, an integrated documentation resource of protein families, domains and functional sites, was created in 1999 as a means of amalgamating the major protein signature databases into one comprehensive resource. PROSITE, Pfam, PRINTS, ProDom, SMART and TIGRFAMs have been manually integrated and curated and are available in InterPro for text- and sequence-based searching. The results are provided in a single format that rationalises the results that would be obtained by searching the member databases individually. The latest release of InterPro contains 5629 entries describing 4280 families, 1239 domains, 95 repeats and 15 post-translational modifications. Currently, the combined signatures in InterPro cover more than 74% of all proteins in SWISS-PROT and TrEMBL, an increase of nearly 15% since the inception of InterPro. New features of the database include improved searching capabilities and enhanced graphical user interfaces for visualisation of the data. The database is available via a webserver (http://www.ebi.ac.uk/interpro) and anonymous FTP (ftp://ftp.ebi.ac.uk/pub/databases/interpro).
Gene Ontology Annotation (GOA) is a project run by the European Bioinformatics Institute (EBI) that aims to provide assignments of terms from the Gene Ontology (GO) resource to gene products in a number of its databases (http://www.ebi.ac.uk/GOA). In the first stage of this project, GO assignments have been applied to a data set representing the complete human proteome by a combination of electronic mappings and manual curation. This vocabulary has also been applied to the nonredundant proteome sets for all other completely sequenced organisms as well as to proteins from a wide range of organisms where the proteome is not yet complete.
RNA-mediated interference (RNAi) is a method to inhibit gene function by introduction of double-stranded RNA (dsRNA). Recently, an RNAi library was constructed that consists of bacterial clones expressing dsRNA, corresponding to nearly 90% of the 19,427 predicted genes of C. elegans. Feeding of this RNAi library to the standard wild-type laboratory strain Bristol N2 detected phenotypes for approximately 10% of the corresponding genes. To increase the number of genes for which a loss-of-function phenotype can be detected, we undertook a genome-wide RNAi screen using the rrf-3 mutant strain, which we found to be hypersensitive to RNAi. Feeding of the RNAi library to rrf-3 mutants resulted in additional loss-of-function phenotypes for 393 genes, increasing the number of genes with a phenotype by 23%. These additional phenotypes are distributed over different phenotypic classes. We also studied interexperimental variability in RNAi results and found persistent levels of false negatives. In addition, we used the RNAi phenotypes obtained with the genome-wide screens to systematically clone seven existing genetic mutants with visible phenotypes. The genome-wide RNAi screen using rrf-3 significantly increased the functional data on the C. elegans genome. The resulting dataset will be valuable in conjunction with other functional genomics approaches, as well as in other model organisms.
Complete genomic sequence is known for two multicellular eukaryotes, the nematode Caenorhabditis elegans and the fruit fly Drosophila melanogaster, and it will soon be known for humans. However, biological function has been assigned to only a small proportion of the predicted genes in any animal. Here we have used RNA-mediated interference (RNAi) to target nearly 90% of predicted genes on C. elegans chromosome I by feeding worms with bacteria that express double-stranded RNA. We have assigned function to 13.9% of the genes analysed, increasing the number of sequenced genes with known phenotypes on chromosome I from 70 to 378. Although most genes with sterile or embryonic lethal RNAi phenotypes are involved in basal cell metabolism, many genes giving post-embryonic phenotypes have conserved sequences but unknown function. In addition, conserved genes are significantly more likely to have an RNAi phenotype than are genes with no conservation. We have constructed a reusable library of bacterial clones that will permit unlimited RNAi screens in the future; this should help develop a more complete view of the relationships between the genome, gene function and the environment.