ars-2 | GeneID:171985 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 171985 Official Symbol ars-2
Locus F28H1.3 Gene Type protein-coding
Synonyms
Full Name N/A
Description Alanyl tRNA Synthetase
Chromosome N/A
Also Known As Alanyl tRNA Synthetase family member (ars-2)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1213

ID Symbol Protein Species
GeneID:16 AARS NP_001596.2 Homo sapiens
GeneID:34156 Aats-ala NP_523511.2 Drosophila melanogaster
GeneID:171985 ars-2 NP_491281.1 Caenorhabditis elegans
GeneID:234734 Aars NP_666329.2 Mus musculus
GeneID:292023 Aars XP_214690.3 Rattus norvegicus
GeneID:324940 aars NP_001037775.1 Danio rerio
GeneID:415668 AARS NP_001005836.1 Gallus gallus
GeneID:454210 AARS XP_001169474.1 Pan troglodytes
GeneID:479656 AARS XP_536788.2 Canis lupus familiaris
GeneID:510933 AARS XP_588170.3 Bos taurus
GeneID:814313 PF13_0354 XP_001350388.1 Plasmodium falciparum
GeneID:841442 ALATS NP_175439.2 Arabidopsis thaliana
GeneID:854513 ALA1 NP_014980.1 Saccharomyces cerevisiae
GeneID:1279087 AgaP_AGAP009701 XP_318757.2 Anopheles gambiae
GeneID:2542031 SPAC23C11.09 NP_593640.1 Schizosaccharomyces pombe
GeneID:2676649 MGG_03607 XP_361064.2 Magnaporthe grisea
GeneID:2713811 NCU02566.1 XP_331765.1 Neurospora crassa
GeneID:2894909 KLLA0F02431g XP_455190.1 Kluyveromyces lactis
GeneID:4348211 Os10g0182000 NP_001064254.1 Oryza sativa
GeneID:4620624 AGOS_ADR363C NP_984459.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0004813 Function alanine-tRNA ligase activity
GO:0005524 Function ATP binding
GO:0016876 Function ligase activity, forming aminoacyl-tRNA and related compounds
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0009792 Process embryonic development ending in birth or egg hatching
GO:0040007 Process growth
GO:0040011 Process locomotion
GO:0002119 Process nematode larval development
GO:0040010 Process positive regulation of growth rate
GO:0000003 Process reproduction
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_058880 NP_491281

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F28H1.3.1 MI0000333 cel-miR-256 UGGAAUGCAUAGAAGACUGUA
F28H1.3.3 MI0000318 cel-miR-242 UUGCGUAGGCCUUUGCUUCGA
F28H1.3.3 MI0000333 cel-miR-256 UGGAAUGCAUAGAAGACUGUA
F28H1.3.3 MI0005193 cel-miR-792 UUGAAAUCUCUUCAACUUUCAGA
F28H1.3.3 MI0005200 cel-miR-799 UGAACCCUGAUAAAGCUAGUGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_058880  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sonnichsen B, et al. (2005) "Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans." Nature. 434(7032):462-469. PMID:15791247
  2. [ + ] Rual JF, et al. (2004) "Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library." Genome Res. 14(10B):2162-2168. PMID:15489339
  3. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  4. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719
  5. [ + ] Simmer F, et al. (2003) "Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions." PLoS Biol. 1(1):E12. PMID:14551910
  6. [ + ] Fraser AG, et al. (2000) "Functional genomic analysis of C. elegans chromosome I by systematic RNA interference." Nature. 408(6810):325-330. PMID:11099033