aat-5 | GeneID:171814 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 171814 Official Symbol aat-5
Locus C55C2.5 Gene Type protein-coding
Synonyms
Full Name N/A
Description Amino Acid Transporter
Chromosome N/A
Also Known As Amino Acid Transporter family member (aat-5)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68710

ID Symbol Protein Species
GeneID:171814 aat-5 NP_491003.2 Caenorhabditis elegans
GeneID:177388 aat-4 NP_001023382.1 Caenorhabditis elegans
GeneID:185079 aat-8 NP_500425.2 Caenorhabditis elegans
GeneID:186240 aat-7 NP_493960.2 Caenorhabditis elegans
GeneID:188421 aat-6 NP_505905.2 Caenorhabditis elegans
GeneID:190250 aat-9 NP_001021788.1 Caenorhabditis elegans
GeneID:852946 MUP1 NP_011569.1 Saccharomyces cerevisiae
GeneID:2710414 NCU07754.1 XP_328460.1 Neurospora crassa
GeneID:2897160 KLLA0B13233g XP_452121.1 Kluyveromyces lactis
GeneID:4619036 AGOS_ABL003C NP_982944.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0015171 Function amino acid transmembrane transporter activity
GO:0006865 Process amino acid transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_058601 NP_491002
2 NM_058602 NP_491003
3 NM_182011 NP_871811

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
C55C2.5a MI0000308 cel-miR-233 UUGAGCAAUGCGCAUGUGCGG
C55C2.5a MI0000005 cel-miR-34 AGGCAGUGUGGUUAGCUGGUUG
C55C2.5a MI0000755 cel-miR-356 UUGAGCAACGCGAACAAAUCA
C55C2.5b MI0000308 cel-miR-233 UUGAGCAAUGCGCAUGUGCGG
C55C2.5b MI0000005 cel-miR-34 AGGCAGUGUGGUUAGCUGGUUG
C55C2.5b MI0000755 cel-miR-356 UUGAGCAACGCGAACAAAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719