aat-5 | GeneID:171814 | Caenorhabditis elegans
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 171814 | Official Symbol | aat-5 |
|---|---|---|---|
| Locus | C55C2.5 | Gene Type | protein-coding |
| Synonyms | |||
| Full Name | N/A | ||
| Description | Amino Acid Transporter | ||
| Chromosome | N/A | ||
| Also Known As | Amino Acid Transporter family member (aat-5) | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 68710
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:171814 | aat-5 | NP_491003.2 | Caenorhabditis elegans |
| GeneID:177388 | aat-4 | NP_001023382.1 | Caenorhabditis elegans |
| GeneID:185079 | aat-8 | NP_500425.2 | Caenorhabditis elegans |
| GeneID:186240 | aat-7 | NP_493960.2 | Caenorhabditis elegans |
| GeneID:188421 | aat-6 | NP_505905.2 | Caenorhabditis elegans |
| GeneID:190250 | aat-9 | NP_001021788.1 | Caenorhabditis elegans |
| GeneID:852946 | MUP1 | NP_011569.1 | Saccharomyces cerevisiae |
| GeneID:2710414 | NCU07754.1 | XP_328460.1 | Neurospora crassa |
| GeneID:2897160 | KLLA0B13233g | XP_452121.1 | Kluyveromyces lactis |
| GeneID:4619036 | AGOS_ABL003C | NP_982944.1 | Eremothecium gossypii |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0015171 | Function | amino acid transmembrane transporter activity |
| GO:0006865 | Process | amino acid transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| C55C2.5a | MI0000308 | cel-miR-233 | UUGAGCAAUGCGCAUGUGCGG |
| C55C2.5a | MI0000005 | cel-miR-34 | AGGCAGUGUGGUUAGCUGGUUG |
| C55C2.5a | MI0000755 | cel-miR-356 | UUGAGCAACGCGAACAAAUCA |
| C55C2.5b | MI0000308 | cel-miR-233 | UUGAGCAAUGCGCAUGUGCGG |
| C55C2.5b | MI0000005 | cel-miR-34 | AGGCAGUGUGGUUAGCUGGUUG |
| C55C2.5b | MI0000755 | cel-miR-356 | UUGAGCAACGCGAACAAAUCA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011 - [
] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719
InterPro, an integrated documentation resource of protein families, domains and functional sites, was created in 1999 as a means of amalgamating the major protein signature databases into one comprehensive resource. PROSITE, Pfam, PRINTS, ProDom, SMART and TIGRFAMs have been manually integrated and curated and are available in InterPro for text- and sequence-based searching. The results are provided in a single format that rationalises the results that would be obtained by searching the member databases individually. The latest release of InterPro contains 5629 entries describing 4280 families, 1239 domains, 95 repeats and 15 post-translational modifications. Currently, the combined signatures in InterPro cover more than 74% of all proteins in SWISS-PROT and TrEMBL, an increase of nearly 15% since the inception of InterPro. New features of the database include improved searching capabilities and enhanced graphical user interfaces for visualisation of the data. The database is available via a webserver (http://www.ebi.ac.uk/interpro) and anonymous FTP (ftp://ftp.ebi.ac.uk/pub/databases/interpro).
Gene Ontology Annotation (GOA) is a project run by the European Bioinformatics Institute (EBI) that aims to provide assignments of terms from the Gene Ontology (GO) resource to gene products in a number of its databases (http://www.ebi.ac.uk/GOA). In the first stage of this project, GO assignments have been applied to a data set representing the complete human proteome by a combination of electronic mappings and manual curation. This vocabulary has also been applied to the nonredundant proteome sets for all other completely sequenced organisms as well as to proteins from a wide range of organisms where the proteome is not yet complete.