abtm-1 | GeneID:171807 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 171807 Official Symbol abtm-1
Locus Y74C10AR.3 Gene Type protein-coding
Synonyms
Full Name N/A
Description ABC Transporter, Mitochondrial
Chromosome N/A
Also Known As ABC Transporter, Mitochondrial family member (abtm-1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3175

ID Symbol Protein Species
GeneID:22 ABCB7 NP_004290.2 Homo sapiens
GeneID:38193 CG7955 NP_728642.2 Drosophila melanogaster
GeneID:171807 abtm-1 NP_001021830.1 Caenorhabditis elegans
GeneID:302395 Abcb7 NP_997683.1 Rattus norvegicus
GeneID:422326 ABCB7 XP_420301.1 Gallus gallus
GeneID:491967 ABCB7 XP_549087.1 Canis lupus familiaris
GeneID:533669 ABCB7 XP_613148.2 Bos taurus
GeneID:566515 wu:fc20c02 XP_694879.2 Danio rerio
GeneID:828980 ATM2 NP_194591.1 Arabidopsis thaliana
GeneID:828981 ATM1 NP_567813.1 Arabidopsis thaliana
GeneID:835939 STA1 NP_200635.1 Arabidopsis thaliana
GeneID:855347 ATM1 NP_014030.1 Saccharomyces cerevisiae
GeneID:1276974 AgaP_AGAP006364 XP_316391.2 Anopheles gambiae
GeneID:2542779 atm1 NP_594288.2 Schizosaccharomyces pombe
GeneID:2676565 MGG_03406 XP_360863.1 Magnaporthe grisea
GeneID:2706358 NCU05029.1 XP_324386.1 Neurospora crassa
GeneID:2896392 KLLA0A10131g XP_451443.1 Kluyveromyces lactis
GeneID:4622625 AGOS_AGL335W NP_986332.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0009792 Process embryonic development ending in birth or egg hatching
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001026659 NP_001021830

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
Y74C10AR.3 MI0000308 cel-miR-233 UUGAGCAAUGCGCAUGUGCGG
Y74C10AR.3 MI0000346 cel-miR-266 AGGCAAGACUUUGGCAAAGC
Y74C10AR.3 MI0000349 cel-miR-269 GGCAAGACUCUGGCAAAACU
Y74C10AR.3 MI0000043 cel-miR-72 AGGCAAGAUGUUGGCAUAGCUGA
Y74C10AR.3 MI0000044 cel-miR-73 UGGCAAGAUGUAGGCAGUUCAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sonnichsen B, et al. (2005) "Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans." Nature. 434(7032):462-469. PMID:15791247
  2. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  3. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719