abt-2 | GeneID:171782 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 171782 Official Symbol abt-2
Locus F12B6.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description ABC Transporter family
Chromosome N/A
Also Known As ABC Transporter family member (abt-2)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 298

ID Symbol Protein Species
GeneID:24 ABCA4 NP_000341.2 Homo sapiens
GeneID:11304 Abca4 NP_031404.1 Mus musculus
GeneID:171782 abt-2 NP_490949.3 Caenorhabditis elegans
GeneID:281584 ABCA4 NP_776646.1 Bos taurus
GeneID:310836 Abca4 XP_241525.3 Rattus norvegicus
GeneID:424490 ABCA4 XP_422330.2 Gallus gallus
GeneID:444852 ABCA4 NP_001003360.2 Canis lupus familiaris
GeneID:555506 LOC555506 XP_683123.3 Danio rerio
GeneID:745972 ABCA4 XP_001152577.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_058548 NP_490949

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F12B6.1 MI0000004 cel-miR-2 UAUCACAGCCAGCUUUGAUGUGC
F12B6.1 MI0000005 cel-miR-34 AGGCAGUGUGGUUAGCUGGUUG
F12B6.1 MI0000022 cel-miR-51 UACCCGUAGCUCCUAUCCAUGUU
F12B6.1 MI0000023 cel-miR-52 CACCCGUACAUAUGUUUCCGUGCU
F12B6.1 MI0000024 cel-miR-53 CACCCGUACAUUUGUUUCCGUGCU
F12B6.1 MI0000025 cel-miR-54 UACCCGUAAUCUUCAUAAUCCGAG
F12B6.1 MI0000026 cel-miR-55 UACCCGUAUAAGUUUCUGCUGAG
F12B6.1 MI0000027 cel-miR-56 UACCCGUAAUGUUUCCGCUGAG
F12B6.1 MI0005198 cel-miR-797 UAUCACAGCAAUCACAAUGAGAAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_058548  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719