ABHD3 | GeneID:171586 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 171586 Official Symbol ABHD3
Locus N/A Gene Type protein-coding
Synonyms LABH3; MGC11259
Full Name abhydrolase domain containing 3
Description abhydrolase domain containing 3
Chromosome 18q11.2
Also Known As alpha/beta hydrolase domain containing protein 3; lung alpha/beta hydrolase 3
Summary This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. The function of this protein has not been determined. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 14055

ID Symbol Protein Species
GeneID:35930 CG8058 NP_610459.2 Drosophila melanogaster
GeneID:106861 Abhd3 NP_598891.1 Mus musculus
GeneID:171586 ABHD3 NP_612213.2 Homo sapiens
GeneID:180309 Y60A3A.7 NP_507863.1 Caenorhabditis elegans
GeneID:180450 C44C1.5 NP_001024458.1 Caenorhabditis elegans
GeneID:291793 Abhd3 XP_214618.4 Rattus norvegicus
GeneID:421068 ABHD3 XP_419156.2 Gallus gallus
GeneID:447830 abhd3 NP_001004569.1 Danio rerio
GeneID:480177 ABHD3 XP_537301.2 Canis lupus familiaris
GeneID:539795 ABHD3 NP_001069655.1 Bos taurus
GeneID:824243 AT3G50790 NP_190648.1 Arabidopsis thaliana
GeneID:1270246 AgaP_AGAP006819 XP_308926.2 Anopheles gambiae
GeneID:4330156 Os02g0649400 NP_001047583.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA010729 Anti-ABHD3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_138340  UCSC Browser NP_612213 B0YIV0   Q8WU67  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000289119 MI0000446 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000289119 MI0000470 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000289119 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000289119 MI0000449 hsa-miR-132 UAACAGUCUACAGCCAUGGUCG
ENST00000289119 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000289119 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000289119 MI0000475 hsa-miR-136* CAUCAUCGUCUCAAAUGAGUCU
ENST00000289119 MI0000477 hsa-miR-146a* CCUCUGAAAUUCAGUUCUUCAG
ENST00000289119 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000289119 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000289119 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000289119 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000289119 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENST00000289119 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENST00000289119 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000289119 MI0000760 hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC
ENST00000289119 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000289119 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000289119 MI0000782 hsa-miR-374a* CUUAUCAGAUUGUAUUGUAAUU
ENST00000289119 MI0005566 hsa-miR-374b* CUUAGCAGGUUGUAUUAUCAUU
ENST00000289119 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENST00000289119 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000289119 MI0001446 hsa-miR-424* CAAAACGUGAGGCGCUGCUAU
ENST00000289119 MI0001641 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
ENST00000289119 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENST00000289119 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENST00000289119 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENST00000289119 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000289119 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENST00000289119 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENST00000289119 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000289119 MI0003638 hsa-miR-624* UAGUACCAGUACCUUGUGUUCA
ENST00000289119 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENST00000289119 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENST00000289119 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENST00000289119 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000289119 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000289119 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENST00000289119 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000289119 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000289119 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000289119 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000289119 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000289119 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000289119 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000289119 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000289119 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000289119 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000289119 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000289119 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000289119 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000289119 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000289119 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENST00000289119 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENST00000289119 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENST00000289119 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENST00000289119 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABHD3 mRNA
17562736
Calcitriol
  • Calcitriol results in increased expression of ABHD3 mRNA
16002434
Dietary Fats
  • Dietary Fats results in decreased expression of ABHD3 mRNA
18042831
palm oil
  • palm oil results in decreased expression of ABHD3 mRNA
18042831
pirinixic acid
  • pirinixic acid results in increased expression of ABHD3 mRNA
18301758

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16289102, 16644109
Hepatitis, Toxic inferred via Acetaminophen 2444490, 15968718, 17522070, 17562736, 14986274, 16227642, 16177239, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  2. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  3. [ + ] Edgar AJ, et al. (2002) "Cloning and tissue distribution of three murine alpha/beta hydrolase fold protein cDNAs." Biochem Biophys Res Commun. 292(3):617-625. PMID:11922611
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Yu W, et al. (1997) "Large-scale concatenation cDNA sequencing." Genome Res. 7(4):353-358. PMID:9110174
  6. [ + ] Andersson B, et al. (1996) "A "double adaptor" method for improved shotgun library construction." Anal Biochem. 236(1):107-113. PMID:8619474