A3galt2 | GeneID:171553 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 171553 Official Symbol A3galt2
Locus N/A Gene Type protein-coding
Synonyms
Full Name alpha 1,3-galactosyltransferase 2
Description alpha 1,3-galactosyltransferase 2
Chromosome 5q36
Also Known As alpha 1,3-galactosyltransferase 2 (isoglobotriaosylceramide synthase); iGb3 synthase
Summary UDP-galactose: beta-d-galactosyl-1,4-glucosylceramide alpha-1, 3-galactosyltransferase; involved in the synthesis of the isoglobo-series of glycosphingolipids [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16326

ID Symbol Protein Species
GeneID:127550 A3GALT2 NP_001073907.1 Homo sapiens
GeneID:171553 A3galt2 NP_612533.1 Rattus norvegicus
GeneID:215493 A3galt2 NP_001009819.1 Mus musculus
GeneID:487298 A3GALT2 XP_544424.2 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005794 Component Golgi apparatus
GO:0016020 Component membrane
GO:0030145 Function manganese ion binding
GO:0046872 Function metal ion binding
GO:0047276 Function N-acetyllactosaminide 3-alpha-galactosyltransferase activity
GO:0016757 Function transferase activity, transferring glycosyl groups
GO:0016758 Function transferase activity, transferring hexosyl groups
GO:0005975 Process carbohydrate metabolic process
GO:0006688 Process glycosphingolipid biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_138524  UCSC Browser NP_612533

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000007851 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSRNOT00000007851 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENSRNOT00000007851 MI0005497 mmu-miR-453 AGGUUGCCUCAUAGUGAGCUUGCA
ENSRNOT00000007851 MI0006127 mmu-miR-582-5p UACAGUUGUUCAACCAGUUACU
ENSRNOT00000007851 MI0005520 mmu-miR-654-5p UGGUAAGCUGCAGAACAUGUGU
ENSRNOT00000007851 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSRNOT00000007851 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENSRNOT00000007851 MI0000886 rno-miR-101a UACAGUACUGUGAUAACUGAA
ENSRNOT00000007851 MI0000648 rno-miR-101b UACAGUACUGUGAUAGCUGAA
ENSRNOT00000007851 MI0000929 rno-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSRNOT00000007851 MI0000638 rno-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSRNOT00000007851 MI0003554 rno-miR-20b-5p CAAAGUGCUCAUAGUGCAGGU
ENSRNOT00000007851 MI0000856 rno-miR-25* AGGCGGAGACACGGGCAAUUGC
ENSRNOT00000007851 MI0000861 rno-miR-28* CACUAGAUUGUGAGCUCCUGGA
ENSRNOT00000007851 MI0000624 rno-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSRNOT00000007851 MI0000875 rno-miR-34b UAGGCAGUGUAAUUAGCUGAUUG
ENSRNOT00000007851 MI0000876 rno-miR-34c AGGCAGUGUAGUUAGCUGAUUGC
ENSRNOT00000007851 MI0003720 rno-miR-505 GUCAACACUUGCUGGUUUCC
ENSRNOT00000007851 MI0003525 rno-miR-543* AAACAUUCGCGGUGCACUUCU
ENSRNOT00000007851 MI0006160 rno-miR-708* CAACUAGACUGUGAGCUUCUAG
ENSRNOT00000007851 MI0006120 rno-miR-878 GCAUGACACCAUACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  2. [ + ] Keusch JJ, et al. (2000) "Expression cloning of a new member of the ABO blood group glycosyltransferases, iGb3 synthase, that directs the synthesis of isoglobo-glycosphingolipids." J Biol Chem. 275(33):25308-25314. PMID:10854427