Accn3 | GeneID:171209 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 171209 | Official Symbol | Accn3 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | ASIC3; AW742291; DRASIC; SLNAC1; TNAC1 | ||
| Full Name | amiloride-sensitive cation channel 3 | ||
| Description | amiloride-sensitive cation channel 3 | ||
| Chromosome | 5 A3 | ||
| Also Known As | |||
| Summary | N/A | ||
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | sigma | S5070 | Anti-Sodium Channel ASIC3 antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0016021 | Component | integral to membrane |
| GO:0005887 | Component | integral to plasma membrane |
| GO:0016020 | Component | membrane |
| GO:0005886 | Component | plasma membrane |
| GO:0015280 | Function | amiloride-sensitive sodium channel activity |
| GO:0005261 | Function | cation channel activity |
| GO:0005216 | Function | ion channel activity |
| GO:0005272 | Function | sodium channel activity |
| GO:0031402 | Function | sodium ion binding |
| GO:0006812 | Process | cation transport |
| GO:0050907 | Process | detection of chemical stimulus involved in sensory perception |
| GO:0050968 | Process | detection of chemical stimulus involved in sensory perception of pain |
| GO:0050974 | Process | detection of mechanical stimulus involved in sensory perception |
| GO:0050966 | Process | detection of mechanical stimulus involved in sensory perception of pain |
| GO:0050961 | Process | detection of temperature stimulus involved in sensory perception |
| GO:0050965 | Process | detection of temperature stimulus involved in sensory perception of pain |
| GO:0006811 | Process | ion transport |
| GO:0001101 | Process | response to acid |
| GO:0009408 | Process | response to heat |
| GO:0009612 | Process | response to mechanical stimulus |
| GO:0006814 | Process | sodium ion transport |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000049346 | MI0003636 | hsa-miR-622 | ACAGUCUGCUGAGGUUGGAGC |
| ENSMUST00000049346 | MI0003650 | hsa-miR-635 | ACUUGGGCACUGAAACAAUGUCC |
| ENSMUST00000049346 | MI0003665 | hsa-miR-650 | AGGAGGCAGCGCUCUCAGGAC |
| ENSMUST00000049346 | MI0003669 | hsa-miR-661 | UGCCUGGGUCUCUGGCCUGCGCGU |
| ENSMUST00000049346 | MI0000609 | mmu-miR-331-3p | GCCCCUGGGCCUAUCCUAGAA |
| ENSMUST00000049346 | MI0000615 | mmu-miR-337-5p | GAACGGCGUCAUGCAGGAGUU |
| ENSMUST00000049346 | MI0004965 | mmu-miR-652 | AAUGGCGCCACUAGGGUUGUG |
| ENSMUST00000049346 | MI0004677 | mmu-miR-696 | GCGUGUGCUUGCUGUGGG |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Ikeuchi M, et al. (2009) "Acid-sensing ion channel 3 expression in mouse knee joint afferents and effects of carrageenan-induced arthritis." J Pain. 10(3):336-342. PMID:19185546 - [
] Burnes LA, et al. (2008) "Enhanced muscle fatigue occurs in male but not female ASIC3-/- mice." Am J Physiol Regul Integr Comp Physiol. 294(4):R1347-R1355. PMID:18305024 - [
] Bielefeldt K, et al. (2008) "Differential effects of ASIC3 and TRPV1 deletion on gastroesophageal sensation in mice." Am J Physiol Gastrointest Liver Physiol. 294(1):G130-G138. PMID:17975130 - [
] Huang SJ, et al. (2008) "Increase of insulin sensitivity and reversal of age-dependent glucose intolerance with inhibition of ASIC3." Biochem Biophys Res Commun. 371(4):729-734. PMID:18466760 - [
] Ikeuchi M, et al. (2008) "Role of ASIC3 in the primary and secondary hyperalgesia produced by joint inflammation in mice." Pain. 137(3):662-669. PMID:18343037 - [
] Lin YW, et al. (2008) "Identification and characterization of a subset of mouse sensory neurons that express acid-sensing ion channel 3." Neuroscience. 151(2):544-557. PMID:18082972 - [
] Jones RC 3rd, et al. (2007) "Short-term sensitization of colon mechanoreceptors is associated with long-term hypersensitivity to colon distention in the mouse." Gastroenterology. 133(1):184-194. PMID:17553498 - [
] Huang CW, et al. (2007) "Nociceptors of dorsal root ganglion express proton-sensing G-protein-coupled receptors." Mol Cell Neurosci. 36(2):195-210. PMID:17720533 - [
] Sluka KA, et al. (2007) "ASIC3 in muscle mediates mechanical, but not heat, hyperalgesia associated with muscle inflammation." Pain. 129(1-2):102-112. PMID:17134831 - [
] Page AJ, et al. (2007) "Acid sensing ion channels 2 and 3 are required for inhibition of visceral nociceptors by benzamil." Pain. 133(1-3):150-160. PMID:17467171 - [
] Hughes PA, et al. (2007) "Localization and comparative analysis of acid-sensing ion channel (ASIC1, 2, and 3) mRNA expression in mouse colonic sensory neurons within thoracolumbar dorsal root ganglia." J Comp Neurol. 500(5):863-875. PMID:17177258 - [
] Yudin YK, et al. (2006) "Peripherally applied neuropeptide SF is equally algogenic in wild type and ASIC3-/- mice." Neurosci Res. 55(4):421-425. PMID:16730827 - [
] Chen CL, et al. (2006) "Runx1 determines nociceptive sensory neuron phenotype and is required for thermal and neuropathic pain." Neuron. 49(3):365-377. PMID:16446141 - [
] Jones RC 3rd, et al. (2005) "The mechanosensitivity of mouse colon afferent fibers and their sensitization by inflammatory mediators require transient receptor potential vanilloid 1 and acid-sensing ion channel 3." J Neurosci. 25(47):10981-10989. PMID:16306411 - [
] Mogil JS, et al. (2005) "Transgenic expression of a dominant-negative ASIC3 subunit leads to increased sensitivity to mechanical and inflammatory stimuli." J Neurosci. 25(43):9893-9901. PMID:16251436 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Deval E, et al. (2004) "ASIC2b-dependent regulation of ASIC3, an essential acid-sensing ion channel subunit in sensory neurons via the partner protein PICK-1." J Biol Chem. 279(19):19531-19539. PMID:14976185 - [
] Drew LJ, et al. (2004) "Acid-sensing ion channels ASIC2 and ASIC3 do not contribute to mechanically activated currents in mammalian sensory neurones." J Physiol. 556(Pt 3):691-710. PMID:14990679 - [
] Hildebrand MS, et al. (2004) "Characterisation of DRASIC in the mouse inner ear." Hear Res. 190(1-2):149-160. PMID:15051137 - [
] Hruska-Hageman AM, et al. (2004) "PSD-95 and Lin-7b interact with acid-sensing ion channel-3 and have opposite effects on H+- gated current." J Biol Chem. 279(45):46962-46968. PMID:15317815 - [
] Chu XP, et al. (2004) "Subunit-dependent high-affinity zinc inhibition of acid-sensing ion channels." J Neurosci. 24(40):8678-8689. PMID:15470133 - [
] Price MP, et al. (2004) "Stomatin modulates gating of acid-sensing ion channels." J Biol Chem. 279(51):53886-53891. PMID:15471860 - [
] Sluka KA, et al. (2003) "Chronic hyperalgesia induced by repeated acid injections in muscle is abolished by the loss of ASIC3, but not ASIC1." Pain. 106(3):229-239. PMID:14659506 - [
] Benson CJ, et al. (2002) "Heteromultimers of DEG/ENaC subunits form H+-gated channels in mouse sensory neurons." Proc Natl Acad Sci U S A. 99(4):2338-2343. PMID:11854527 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Chen CC, et al. (2002) "A role for ASIC3 in the modulation of high-intensity pain stimuli." Proc Natl Acad Sci U S A. 99(13):8992-8997. PMID:12060708 - [
] Xie J, et al. (2002) "DRASIC contributes to pH-gated currents in large dorsal root ganglion sensory neurons by forming heteromultimeric channels." J Neurophysiol. 87(6):2835-2843. PMID:12037186 - [
] Price MP, et al. (2001) "The DRASIC cation channel contributes to the detection of cutaneous touch and acid stimuli in mice." Neuron. 32(6):1071-1083. PMID:11754838 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Askwith CC, et al. (2000) "Neuropeptide FF and FMRFamide potentiate acid-evoked currents from sensory neurons and proton-gated DEG/ENaC channels." Neuron. 26(1):133-141. PMID:10798398 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
Arthritis is associated with decreases in local pH. Of the acid-sensing ion channels (ASIC), ASIC3 is most sensitive to such a pH change, abundantly expressed in dorsal root ganglion (DRG), and critical for the development of secondary hyperalgesia. The purpose of this study was to investigate the upregulation of ASIC3, using an acute arthritic pain model in mice. We examined ASIC3 expression in DRG neurons innervating the knee joint with and without carrageenan-induced arthritis by means of retrograde labeling and immunohistochemistry. We also examined the difference of DRG phenotype between ASIC3+/+ and ASIC3-/- mice. ASIC3 immunoreactivity was present in 31% of knee joint afferents and dominantly in small cells. After joint inflammation, ASIC3-immunoreactive neurons significantly increased in number by 50%. Calcitonin gene-related peptide (CGRP) increased similarly in both ASIC3+/+ and ASIC3-/- mice. Soma size distribution of ASIC3-immunoreactive neurons without CGRP expression was shifted to smaller-diameter neurons. Our results suggest that ASIC3 plays an important role in acute arthritic pain. Specifically, we propose that ASIC3 upregulation along with CGRP and phenotypic change in ASIC3-immunoreactive neurons without CGRP are responsible for the development of secondary hyperalgesia after carrageenan-induced arthritis. PERSPECTIVE: This article shows that ASIC3 is upregulated along with CGRP in knee joint afferents and that there is a phenotypic change in ASIC3-immunoreactive nonpeptidergic neurons in an animal model of acute arthritis. Understanding the basic neurobiology after acute arthritis could lead to future new pharmacological management of arthritis.
Muscle fatigue is associated with a number of clinical diseases, including chronic pain conditions. Decreases in extracellular pH activates acid-sensing ion channel 3 (ASIC3), depolarizes muscle, protects against fatigue, and produces pain. We examined whether ASIC3-/- mice were more fatigable than ASIC3+/+ mice in a task-dependent manner. We developed two exercise protocols to measure exercise-induced muscle fatigue: (fatigue task 1, three 1-h runs; fatigue task 2, three 30-min runs). In fatigue task 1, male ASIC3+/+ mice muscle showed less fatigue than male ASIC3-/- mice and female ASIC3+/+ mice. No differences in fatigue were observed in fatigue task 2. We then tested whether the development of muscle fatigue was dependent on sex and modulated by testosterone. Female ASIC3+/+ mice that were ovariectomized and administered testosterone developed less muscle fatigue than female ASIC3+/+ mice and behaved similarly to male ASIC3+/+ mice. However, testosterone was unable to rescue the muscle fatigue responses in ovariectomized ASIC3-/- mice. Plasma levels of testosterone from male ASIC3-/- mice were significantly lower than in male ASIC3+/+ mice and were similar to female ASIC3+/+ mice. Muscle fiber types, measured by counting ATPase-stained whole muscle sections, were similar in calf muscles from male and female ASIC3+/+ mice. These data suggest that both ASIC3 and testosterone are necessary to protect against muscle fatigue in a task-dependent manner. Also, differences in expression of ASIC3 and the development of exercise-induced fatigue could explain the female predominance in clinical syndromes of pain that include muscle fatigue.
Using a recently developed in vitro preparation of vagal afferent pathways, we examined the role of TRPV1 and ASIC3 on the mechano- and chemosensitive properties of gastroesophageal sensory neurons. Esophagus, stomach, and the intact vagus nerves up to the central terminations were carefully dissected from TRPV1 and ASIC3 knockout mice and wild-type controls. The organ preparation was placed in a superfusion chamber to obtain intracellular recordings from the soma of nodose neurons during luminal stimulation of esophagus and stomach. The proximal esophagus and distal stomach were separately intubated to allow perfusion and graded luminal distension. In wild-type mice, mechanosensitive neurons were activated by low distension pressures and encoded stimulus intensity over the entire range tested. Luminal acidification significantly transiently increased the resting frequency but did not alter responses to subsequent mechanical stimulation. ASIC3 and TRPV1 knockout significantly blunted responses to distension compared with wild-type controls, with deletion of TRPV1 having a more significant effect than ASIC3 deletion. Luminal acidification did not activate mechanosensory neurons in ASIC3 and TRPV1 knockout mice. Our data demonstrate a role of TRPV1 in chemo- and mechanosensation of gastroesophageal afferents. ASIC3 may contribute to acid sensation but plays a more subtle role in responses to distending stimuli. Considering the importance of acid in dyspeptic symptoms and gastroesophageal reflux, TRPV1 or ASIC3 may be an attractive target for treatment strategies in patients who do not respond to acid suppressive therapy.
Glucose tolerance progressively declines with age in humans and is often accompanied by insulin resistance and a high prevalence of type 2 diabetes. Little is known about the mechanism underlying the age-related changes in glucose metabolism. Here we reported that acid-sensing ion channel 3 (ASIC3) is functionally expressed in adipose cells. ASIC3(-/-) mice were protected against age-dependent glucose intolerance with enhanced insulin sensitivity. Acute administration of ASIC3-selective blocker APETx2 improved the glucose control and increased the insulin sensitivity in older (25-27 weeks) ASIC3(+/+) mice. Moreover, the enhanced glucose control in aging ASIC3(-/-) mice was associated with high baseline levels of Akt phosphorylation and high copy number of mitochondrial DNA in adipose tissues. Taken together, our data suggest that ASIC3 signaling might be involved in the control of age-dependent glucose intolerance and insulin resistance.
The acid sensing ion channel 3 (ASIC3) is critical for the development of secondary hyperalgesia as measured by mechanical stimulation of the paw following muscle insult. We designed experiments to test whether ASIC3 was necessary for the development of both primary and secondary mechanical hyperalgesia that develops after joint inflammation. We used ASIC3 -/- mice and examined the primary (response to tweezers) and secondary hyperalgesia (von-Frey filaments) that develops after joint inflammation comparing to ASIC3 +/+ mice. We also examined the localization of ASIC3 to the knee joint afferents innervating the synovium using immunohistochemical techniques before and after joint inflammation. We show that secondary mechanical hyperalgesia does not develop in ASIC3 -/- mice. However, the primary mechanical hyperalgesia of the inflamed knee joint still develops in ASIC3 -/- mice and is similar to ASIC3 +/+ mice. In knee joint synovium from ASIC3 +/+ mice without joint inflammation, ASIC3 was not localized to joint afferents that were stained with an antibody to protein gene product (PGP) 9.5 or calcitonin gene-related peptide (CGRP). ASIC3 was found, however, in synoviocytes of the knee joint of uninflamed mice. In ASIC3 +/+ mice with joint inflammation, ASIC3 co-localized with PGP 9.5 or CGRP in joint afferents innervating the synovium. We conclude that the decreased pH that occurs after inflammation would activate ASIC3 on primary afferent fibers innervating the knee joint, increasing the input to the spinal cord resulting in central sensitization manifested behaviorally as secondary hyperalgesia of the paw.
Acid-sensing ion channel 3 (ASIC3) is the most sensitive acid sensor in sensory neurons that innervate into skin, muscle, heart, and visceral tissues. ASIC3 is involved in ischemia sensing, nociception, mechanosensation, and hearing, but how ASIC3-expressing neurons differ in their firing properties is still unknown. We hypothesized that ASIC3-expressing neurons have specialized firing properties, which, coupled with the heterogeneity of acid-sensing properties, accounts for various physiological roles. Here, we successfully identified ASIC3-expressing lumbar dorsal root ganglion (DRG) neurons whose transient proton-gated currents were blocked by salicylic acid (SA). The salicylic acid-sensitive (SAS) neurons did not exist in DRG neurons of mice lacking ASIC3. SAS neurons expressed distinct electrophysiological properties as compared with other DRG neurons. Especially, SAS neurons fired action potentials (APs) with large overshoot and long afterhyperpolarization duration, which suggests that they belong to nociceptors. SAS neurons also exhibited multiple nociceptor markers such as capsaicin response (38%), action potential (AP) with inflection (35%), or tetrodotoxin resistance (31%). Only in SAS neurons but not other DRG neurons was afterhyperpolarization duration correlated with resting membrane potential and AP duration. Our studies reveal a unique feature of ASIC3-expressing DRG neurons and a basis for their heterogeneous functions.
BACKGROUND & AIMS: Using a mouse model that reproduces major features of irritable bowel syndrome (long-lasting colon hypersensitivity without inflammation), we examined the contributions of 2 proteins, transient receptor potential vanilloid 1 (TRPV1) and acid-sensing ion channel 3 (ASIC3), on development of behavioral hypersensitivity and assessed the function of colon mechanoreceptors of hypersensitive mice. METHODS: Visceral nociceptive behavior was measured as the visceromotor response (VMR) to colorectal distention (CRD) before and after intracolonic treatment with zymosan or saline. Colon pathology was assessed in parallel experiments by quantifying myeloperoxidase activity, intralumenal pH, and tissue histology. Electrophysiologic experiments were performed on naive and zymosan-treated hypersensitive mice using an in vitro colon-pelvic nerve preparation. RESULTS: Zymosan, but not saline, produced significant and persistent increases in the VMRs of control mice; zymosan produced nonsignificant increases in the VMRs in TRPV1 and ASIC3 knockout mice. Colon myeloperoxidase activity and pH were unaffected by either CRD or intracolonic treatments. Pelvic nerve mechanoreceptors recorded from zymosan-treated or naive mice had similar sensitivity to stretch of the colon. When applied acutely, zymosan sensitized muscular/mucosal mechanoreceptors in both naive and hypersensitive mice. CONCLUSIONS: Zymosan produced sensitization of colon mechanoreceptors acutely in vitro and chronic (>or=7 weeks) behavioral hypersensitivity in the absence of inflammation. The behavioral hypersensitivity was partially dependent on both TRPV1 and ASIC3 because deletions of either of these genes blunted zymosan's effect, suggesting that these proteins may be important peripheral mediators for development of functional (ie, noninflammatory) visceral hypersensitivity.
One major goal in pain research is to identify novel pain targets. Tissue injury, inflammation, and ischemia are usually accompanied by local tissue acidosis, the degree of associated pain or discomfort well correlated with the magnitude of acidification. Proton-sensing ion channels, transient receptor potential/vanilloid receptor subtype 1, and acid-sensing ion channel 3 are involved in acidosis-linked pain. However, whether recently identified proton-sensing G-protein-coupled receptors (GPCRs) also have some contributions is unclear. Proton-sensing GPCRs, including OGR1, GPR4, G2A, and TDAG8, are fully activated at pH 6.4-6.8 in vitro. To understand whether the proton-sensing GPCRs are expressed in nociceptors, we cloned the four mouse genes and examined their tissue distribution and localization in pain-relevant loci, the dorsal root ganglion (DRG). The OGR1 family members were widely expressed in neuronal and non-neuronal tissues. Their transcripts were expressed in the DRG, and most (75-82%) were present in small-diameter neurons responsible for nociception. Approximately 31-40% of total DRG neurons expressed at least two proton-sensing GPCRs. We have also demonstrated that gene expression of proton-sensing GPCRs is changed in ASIC3 knockout mice. Our finding suggests that proton-sensing GPCRs could have some roles in nociception or in compensation of loss of ASIC3 gene.
Peripheral initiators of muscle pain are virtually unknown, but likely key to development of chronic pain after muscle insult. The current study tested the hypothesis that ASIC3 in muscle is necessary for development of cutaneous mechanical, but not heat, hyperalgesia induced by muscle inflammation. Using mechanical and heat stimuli, we assessed behavioral responses in ASIC3-/- and ASIC3+/+ mice after induction of carrageenan muscle inflammation. ASIC3-/- mice did not develop cutaneous mechanical hyperalgesia after muscle inflammation when compared to ASIC3+/+ mice; heat hyperalgesia developed similarly between groups. We then tested if the phenotype could be rescued in ASIC3-/- mice by using a recombinant herpes virus vector to express ASIC3 in skin (where testing occurred) or muscle (where inflammation occurred). Infection of mouse DRG neurons with ASIC3-encoding virus resulted in functional expression of ASICs. Injection of ASIC3-encoding virus into muscle or skin of ASIC3-/- mice resulted in ASIC3 mRNA in DRG and protein expression in DRG and the peripheral injection site. Injection of ASIC3-encoding virus into muscle, but not skin, resulted in development of mechanical hyperalgesia similar to that observed in ASIC3+/+ mice. Thus, ASIC3 in primary afferent fibers innervating muscle is critical to development of hyperalgesia that results from muscle insult.
The Deg/ENaC family of ion channels, including ASIC1, 2 and 3, are candidate mechanotransducers in visceral and somatic sensory neurons, although each channel may play a different role in different sensory pathways. Here we determined which distinct populations of visceral sensory neurons are sensitive to the non-selective Deg/ENaC blocker benzamil, and which ASIC channels are targets for benzamil by studying its actions in knockout mice. Single afferent fiber recordings were made in vitro from mouse high threshold colonic thoracolumbar splanchnic afferents and low threshold gastroesophageal vagal afferents. mRNA expression of ASIC subtypes was compared between colonic and gastroesophageal afferents by quantitative RT-PCR of transcripts following laser capture microdissection of retrogradely labeled cell bodies. Mechanosensitivity of colonic afferents was potently reduced by benzamil (10(-6)-3 x 10(-4)M), whereas gastroesophageal afferents were marginally inhibited. Inhibition of colonic afferent mechanosensitivity by benzamil was markedly diminished in ASIC2-/- and ASIC3-/- mice, but unchanged in ASIC1a-/-. Therefore ASIC2 and 3 are targets for benzamil to inhibit colonic afferent mechanosensitivity. Conversely, gastroesophageal afferents are less sensitive to benzamil, and its action depends less on ASIC expression. mRNA for ASIC3 showed higher and ASIC1a showed lower relative expression in colonic afferents from thoracolumbar dorsal root ganglia than in gastric afferents from nodose (vagal) ganglia. These data indicate that ASICs on colonic afferents present distinct pharmacological targets for visceral pain.
Reducing colonic mechanosensitivity is an important potential strategy for reducing visceral pain. Mice lacking acid-sensing ion channels (ASIC) 1, 2, and 3 show altered colonic mechanosensory function, implicating ASICs in the mechanotransduction process. Deletion of ASICs affects mechanotransduction in visceral and cutaneous afferents differently, suggesting differential expression. We determined relative expression of ASIC1, 2, and 3 in mouse thoracolumbar dorsal root ganglia (DRG) by quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) analysis (QPCR) and specifically in retrogradely traced colonic neurons isolated via laser capture microdissection. Localization of ASIC expression in DRG was determined with fluorescence in situ hybridization (FISH) and retrograde tracing. QPCR of whole thoracolumbar DRG revealed and abundance of ASIC2 > ASIC1 > ASIC3. Similarly, FISH of all neurons in thoracolumbar DRG demonstrated that ASIC2 was expressed in the most (40 +/- 1%) neurons, followed by ASIC3 (24 +/- 1%), then ASIC1 (18 +/- 1%). Retrograde tracing from the distal colon labeled 4 +/- 1% of neurons in T10-L1 DRG. In contrast to whole DRG, FISH of colonic neurons showed ASIC3 expression in 73 +/- 2%, ASIC2 in 47 +/- 0.5%, and ASIC1 in 30 +/- 2%. QPCR of laser captured colonic neurons revealed that ASIC3 was the most abundant ASIC transcript, followed by ASIC1, then ASIC2. We conclude that ASIC1, 2, and 3 are expressed preferentially in colonic neurons within thoracolumbar DRG. In particular ASIC3, the least abundant in the general population, is the most abundant ASIC transcript in colonic neurons. The prevalence of ASIC3 in neurons innervating the colon supports electrophysiological data showing that it makes a major contribution to colonic mechanotransduction and therefore may be a target for the treatment of visceral pain.
RFa-related peptides play a significant role in the processing of pain in the CNS of mammals. Recently it has been found that, when applied subcutaneously, these peptides elicit a powerful algogenic effect. The question arises whether this peripheral effect can be connected with the ability of RFa-related peptides to decrease the rate of desensitization of acid sensing ionic channels (ASICs) expressed in primary sensory neurons. We have addressed this question by comparing the effects of neuropeptide SF (NPSF), mammalian RFa peptide, in ASIC3-/- and wild-type C57BL/6J mice. Knockout of ASIC3 gene results in the changes in some of the behavioral parameters. However, subcutaneous injections of the NPSF into the n.saphenous innervation area result in a clearly nociceptive behavior in both strains of mice. There is no significant difference in the total time of licking of injected paw in the ASIC3-/- (194+/-22s) and C57BL/6J (227+/-25s) animals. Thus peripheral algogenic effects of NPSF cannot be explained only in terms of their action on the ASIC3 channels and involves some other, still unidentified mechanism.
In mammals, the perception of pain is initiated by the transduction of noxious stimuli through specialized ion channels and receptors expressed by nociceptive sensory neurons. The molecular mechanisms responsible for the specification of distinct sensory modality are, however, largely unknown. We show here that Runx1, a Runt domain transcription factor, is expressed in most nociceptors during embryonic development but in adult mice, becomes restricted to nociceptors marked by expression of the neurotrophin receptor Ret. In these neurons, Runx1 regulates the expression of many ion channels and receptors, including TRP class thermal receptors, Na+-gated, ATP-gated, and H+-gated channels, the opioid receptor MOR, and Mrgpr class G protein coupled receptors. Runx1 also controls the lamina-specific innervation pattern of nociceptive afferents in the spinal cord. Moreover, mice lacking Runx1 exhibit specific defects in thermal and neuropathic pain. Thus, Runx1 coordinates the phenotype of a large cohort of nociceptors, a finding with implications for pain therapy.
Mechanical hypersensitivity of the colon underlies in part the chronic abdominal pain experienced by patients with irritable bowel syndrome, yet the molecules that confer mechanosensitivity to colon sensory neurons and their contribution to visceral pain are unknown. We tested the hypothesis that transient receptor potential vanilloid 1 (TRPV1) and acid-sensing ion channel 3 (ASIC3) are peripheral mechanosensors in colon afferent neuronal fibers that mediate visceral nociceptive behavior in mice. Visceral nociception, modeled by the visceromotor response to colorectal distension, and colon afferent fiber mechanosensitivity were assessed in control (C57BL/6) mice and two congenic knock-out mouse strains with deletions of either TRPV1 or ASIC3. Phasic colon distension (15-60 mmHg) produced graded behavioral responses in all three mouse strains. However, both TRPV1 and ASIC3 knock-out mice were significantly less sensitive to distension, with an average response magnitude only 58 and 50% of controls, respectively. The behavioral deficits observed in both strains of knock-out mice were associated with a significant and selective reduction in afferent fiber sensitivity to circumferential stretch of the colon, an effect that was mimicked in control preparations by pretreatment with capsazepine, a TRPV1 antagonist, but not amiloride, a nonselective ASIC antagonist (both 500 microM). In addition, whereas stretch-evoked afferent fiber responses were enhanced by chemical inflammatory mediators in control mice, this effect was differentially impaired in both knock-out mouse strains. These results demonstrate a peripheral mechanosensory role for TRPV1 and ASIC3 in the mouse colon that contributes to nociceptive behavior and possibly peripheral sensitization during tissue insult.
Molecular and behavioral evidence suggests that acid-sensing ion channels (ASICs) contribute to pain processing, but an understanding of their precise role remains elusive. Existing ASIC knock-out mouse experiments are complicated by the heteromultimerization of ASIC subunits. Therefore, we have generated transgenic mice that express a dominant-negative form of the ASIC3 subunit that inactivates all native neuronal ASIC-like currents by oligomerization. Using whole-cell patch-clamp recordings, we examined the response properties of acutely isolated dorsal root ganglion neurons to protons (pH 5.0). We found that whereas 33% of the proton-responsive neurons from wild-type mice exhibited an ASIC-like transient response, none of the neurons from the transgenic mice exhibited a transient inward current. Capsaicin-evoked responses mediated by the TRPV1 receptor were unaltered in transgenic mice. Adult male wild-type and transgenic mice were subjected to a battery of behavioral nociceptive assays, including tests of thermal, mechanical, chemical/inflammatory, and muscle pain. The two genotypes were equally sensitive to thermal pain and to thermal hypersensitivity after inflammation. Compared with wild types, however, transgenic mice were more sensitive to a number of modalities, including mechanical pain (von Frey test, tail-clip test), chemical/inflammatory pain (formalin test, 0.6% acetic acid writhing test), mechanical hypersensitivity after zymosan inflammation, and mechanical hypersensitivity after intramuscular injection of hypotonic saline. These data reinforce the hypothesis that ASICs are involved in both mechanical and inflammatory pain, although the increased sensitivity of transgenic mice renders it unlikely that they are direct transducers of nociceptive stimuli.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
ASIC3, an acid-sensing ion channel subunit expressed essentially in sensory neurons, has been proposed to be involved in pain. We show here for the first time that native ASIC3-like currents were increased in cultured dorsal root ganglion (DRG) neurons following protein kinase C (PKC) stimulation. This increase was induced by the phorbol ester PDBu and by pain mediators, such as serotonin, which are known to activate the PKC pathway through their binding to G protein-coupled receptors. We demonstrate that this regulation involves the silent ASIC2b subunit, an ASIC subunit also expressed in sensory neurons. Indeed, heteromultimeric ASIC3/ASIC2b channels, but not homomeric ASIC3 channels, are positively regulated by PKC. The increase of ASIC3/ASIC2b current is accompanied by a shift in its pH dependence toward more physiological pH values and may lead to an increase of sensory neuron excitability. This regulation by PKC requires PICK-1 (protein interacting with C kinase), a PDZ domain-containing protein, which interacts with the ASIC2b C terminus.
The molecular basis of mechanosensory transduction by primary sensory neurones remains poorly understood. Amongst candidate transducer molecules are members of the acid-sensing ion channel (ASIC) family; nerve fibre recordings have shown ASIC2 and ASIC3 null mutants have aberrant responses to suprathreshold mechanical stimuli. Using the neuronal cell body as a model of the sensory terminal we investigated if ASIC2 or 3 contributed to mechanically activated currents in dorsal root ganglion (DRG) neurones. We cultured neurones from ASIC2 and ASIC3 null mutants and compared response properties with those of wild-type controls. Neuronal subpopulations [categorized by cell size, action potential duration and isolectin B4 (IB4) binding] generated distinct responses to mechanical stimulation consistent with their predicted in vivo phenotypes. In particular, there was a striking relationship between action potential duration and mechanosensitivity as has been observed in vivo. Putative low threshold mechanoreceptors exhibited rapidly adapting mechanically activated currents. Conversely, when nociceptors responded they displayed slowly or intermediately adapting currents that were smaller in amplitude than responses of low threshold mechanoreceptor neurones. No differences in current amplitude or kinetics were found between ASIC2 and/or ASIC3 null mutants and controls. Ruthenium red (5 microm) blocked mechanically activated currents in a voltage-dependent manner, with equal efficacy in wild-type and knockout animals. Analysis of proton-gated currents revealed that in wild-type and ASIC2/3 double knockout mice the majority of putative low threshold mechanoreceptors did not exhibit ASIC-like currents but exhibited a persistent current in response to low pH. Our findings are consistent with another ion channel type being important in DRG mechanotransduction.
Within the cochlea, the hair cells detect sound waves and transduce them into receptor potential. The molecular architecture of the highly specialised cochlea is complex and until recently little was known about the molecular interactions which underlie its function. It is now clear that the coordinated expression and interplay of hundreds of genes and the integrity of cochlear cells regulate this function. It was hypothesised that transcripts expressed highly or specifically in the cochlea are likely to have important roles in normal hearing. Microarray analyses of the Soares NMIE library, consisting of 1536 cDNA clones isolated from the mouse inner ear, suggested that the expression of the mechanoreceptor DRASIC was enriched in the cochlea compared to other tissues. This amiloride-sensitive ion channel is a member of the DEG/ENaC superfamily and a potential candidate for the unidentified mechanoelectrical transduction channel of the sensory hair cells of the cochlea. The cochlear-enriched expression of amiloride-sensitive cation channel 3 (ACCN3) was confirmed by quantitative real-time polymerase chain reaction. Using in situ hybridisation and immunofluorescence, DRASIC expression was localised to the cells and neural fibre region of the spiral ganglion. DRASIC protein was also detected in cells of the organ of Corti. DRASIC may be present in cochlear hair cells as the ACCN3 transcript was shown to be expressed in immortalised cell lines that exhibit characteristics of hair cells. The normal mouse ACCN3 cDNA and an alternatively spliced transcript were elucidated by reverse transcription polymerase chain reaction from mouse inner ear RNA. This transcript may represent a new protein isoform with an as yet unknown function. A DRASIC knockout mouse model was tested for a hearing loss phenotype and was found to have normal hearing at 2 months of age but appeared to develop hearing loss early in life. The human homologue of ACCN3, acid-sensing ion channel 3, maps to the same chromosomal region as the autosomal recessive hearing loss locus DFNB13. However, we did not detect mutations in this gene in a family with DFNB13 hearing loss.
The acid-sensing ion channel-3 (ASIC3) is a degenerin/epithelial sodium channel expressed in the peripheral nervous system. Previous studies indicate that it participates in the response to mechanical and painful stimuli, perhaps contributing to mechanoreceptor and/or H+ -gated nociceptor function. ASIC3 subunits contain intracellular N and C termini that may control channel localization and function. We found that a PDZ-binding motif at the ASIC3 C terminus interacts with four different proteins that contain PDZ domains: PSD-95, Lin-7b, MAGI-1b, and PIST. ASIC3 and these interacting proteins were expressed in dorsal root ganglia and spinal cord, and PSD-95 co-precipitated ASIC3 from spinal cord. When expressed in heterologous cells, PSD-95 reduced the amplitude of ASIC3 acid-evoked currents, whereas Lin-7b increased current amplitude. PSD-95 and Lin-7b altered current density by decreasing or increasing, respectively, the amount of ASIC3 on the cell surface. The finding that multiple PDZ-containing proteins bind ASIC3 and can influence its presence in the plasma membrane suggests that they may play an important role in the contribution of ASIC3 to nociception and mechanosensation.
Acid-sensing ion channels (ASICs), a novel class of ligand-gated cation channels activated by protons, are highly expressed in peripheral sensory and central neurons. Activation of ASICs may play an important role in physiological processes such as nociception, mechanosensation, and learning-memory, and in the pathology of neurological conditions such as brain ischemia. Modulation of the activities of ASICs is expected to have a significant influence on the roles that these channels can play in both physiological and/or pathological processes. Here we show that the divalent cation Zn2+, an endogenous trace element, dose-dependently inhibits ASIC currents in cultured mouse cortical neurons at nanomolar concentrations. With ASICs expressed in Chinese hamster ovary cells, Zn2+ inhibits currents mediated by homomeric ASIC1a and heteromeric ASIC1a-ASIC2a channels, without affecting currents mediated by homomeric ASIC1beta, ASIC2a, or ASIC3. Consistent with ASIC1a-specific modulation, high-affinity Zn2+ inhibition is absent in neurons from ASIC1a knock-out mice. Current-clamp recordings and Ca2+-imaging experiments demonstrated that Zn2+ inhibits acid-induced membrane depolarization and the increase of intracellular Ca2+. Mutation of lysine-133 in the extracellular domain of the ASIC1a subunit abolishes the high-affinity Zn2+ inhibition. Our studies suggest that Zn2+ may play an important role in a negative feedback system for preventing overexcitation of neurons during normal synaptic transmission and ASIC1a-mediated excitotoxicity in pathological conditions.
Acid-sensing ion channels (ASICs) are H(+)-gated members of the degenerin/epithelial Na(+) channel (DEG/ENaC) family in vertebrate neurons. Several ASICs are expressed in sensory neurons, where they play a role in responses to nociceptive, taste, and mechanical stimuli; others are expressed in central neurons, where they participate in synaptic plasticity and some forms of learning. Stomatin is an integral membrane protein found in lipid/protein-rich microdomains, and it is believed to regulate the function of ion channels and transporters. In Caenorhabditis elegans, stomatin homologs interact with DEG/ENaC channels, which together are necessary for normal mechanosensation in the worm. Therefore, we asked whether stomatin interacts with and modulates the function of ASICs. We found that stomatin co-immunoprecipitated and co-localized with ASIC proteins in heterologous cells. Moreover, stomatin altered the function of ASIC channels. Stomatin potently reduced acid-evoked currents generated by ASIC3 without changing steady state protein levels or the amount of ASIC3 expressed at the cell surface. In contrast, stomatin accelerated the desensitization rate of ASIC2 and heteromeric ASICs, whereas current amplitude was unaffected. These data suggest that stomatin binds to and alters the gating of ASICs. Our findings indicate that modulation of DEG/ENaC channels by stomatin-like proteins is evolutionarily conserved and may have important implications for mammalian nociception and mechanosensation.
Clinically, chronic pain and hyperalgesia induced by muscle injury are disabling and difficult to treat. Cellular and molecular mechanisms underlying chronic muscle-induced hyperalgesia are not well understood. For this reason, we developed an animal model where repeated injections of acidic saline into one gastrocnemius muscle produce bilateral, long-lasting mechanical hypersensitivity of the paw (i.e. hyperalgesia) without associated tissue damage. Since acid sensing ion channels (ASICs) are found on primary afferent fibers and respond to decreases in pH, we tested the hypothesis that ASICs on primary afferent fibers innervating muscle are critical to development of hyperalgesia and central sensitization in response to repeated intramuscular acid. Dorsal root ganglion neurons innervating muscle express ASIC3 and respond to acidic pH with fast, transient inward and sustained currents that resemble those of ASICs. Mechanical hyperalgesia produced by repeated intramuscular acid injections is prevented by prior treatment of the muscle with the non-selective ASIC antagonist, amiloride, suggesting ASICs might be involved. ASIC3 knockouts do not develop mechanical hyperalgesia to repeated intramuscular acid injection when compared to wildtype littermates. In contrast, ASIC1 knockouts develop hyperalgesia similar to their wildtype littermates. Extracellular recordings of spinal wide dynamic range (WDR) neurons from wildtype mice show an expansion of the receptive field to include the contralateral paw, an increased response to von Frey filaments applied to the paw both ipsilaterally and contralaterally, and increased response to noxious pinch contralaterally after the second intramuscular acid injection. These changes in WDR neurons do not occur in ASIC3 knockouts. Thus, activation of ASIC3s on muscle afferents is required for development of mechanical hyperalgesia and central sensitization that normally occurs in response to repeated intramuscular acid. Therefore, interfering with ASIC3 might be of benefit in treatment or prevention of chronic hyperalgesia.
Acidic extracellular solution activates transient H(+)-gated currents in dorsal root ganglion (DRG) neurons. The biophysical properties of three degenerin/epithelial sodium (DEG/ENaC) channel subunits (BNC1, ASIC, and DRASIC), and their expression in DRG, suggest that they might underlie these H(+)-gated currents and function as sensory transducers. However, it is uncertain which of these DEG/ENaC subunits generate the currents, and whether they function as homomultimers or heteromultimers. We found that the biophysical properties of transient H(+)-gated currents from medium to large mouse DRG neurons differed from BNC1, ASIC, or DRASIC expressed individually, but were reproduced by coexpression of the subunits together. To test the contribution of each subunit, we studied DRG from three strains of mice, each bearing a targeted disruption of BNC1, ASIC, or DRASIC. Deletion of any one subunit did not abolish H(+)-gated currents, but altered currents in a manner consistent with heteromultimerization of the two remaining subunits. These data indicate that combinations of two or more DEG/ENaC subunits coassemble as heteromultimers to generate transient H(+)-gated currents in mouse DRG neurons.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
Acid-sensing ion channel 3 (ASIC3), a proton-gated ion channel of the degenerins/epithelial sodium channel (DEG/ENaC) receptor family is expressed predominantly in sensory neurons including nociceptive neurons responding to protons. To study the role of ASIC3 in pain signaling, we generated ASIC3 knockout mice. Mutant animals were healthy and responded normally to most sensory stimuli. However, in behavioral assays for pain responses, ASIC3 null mutant mice displayed a reduced latency to the onset of pain responses, or more pain-related behaviors, when stimuli of moderate to high intensity were used. This unexpected effect seemed independent of the modality of the stimulus and was observed in the acetic acid-induced writhing test (0.6 vs. 0.1-0.5%), in the hot-plate test (52.5 and 55 vs. 50 degrees C), and in tests for mechanically induced pain (tail-pinch vs. von Frey filaments). We postulate that ASIC3 is involved in modulating moderate- to high-intensity pain sensation.
For many years it has been observed that extracellular acid activates transient cation currents in large-diameter mechanosensory dorsal root ganglion (DRG) neurons. However, the molecular basis of these currents has not been known. Large DRG neurons express the dorsal root acid sensing ion channel (DRASIC), suggesting that DRASIC might contribute to H+-gated DRG currents. To test this, we examined whole cell currents in large DRG neurons from mice in which the DRASIC gene had been disrupted. We found that DRASIC null neurons retained H+-gated currents, indicating that DRASIC alone was not required for the currents. However, without DRASIC, the properties of the currents changed substantially as compared with wild-type neurons. In DRASIC -/- neurons, the rate of current desensitization in the continued presence of an acid stimulus slowed dramatically. H+-gated currents in DRASIC null neurons showed a decreased sensitivity to pH and an enhanced sensitivity to amiloride. The loss of DRASIC also altered but did not abolish the current potentiation generated by FMRF-related peptides. These data indicate that the DRASIC subunit makes an important contribution to H+-gated currents in large DRG sensory neurons. The results also suggest that related acid-activated DEG/ENaC channel subunits contribute with DRASIC to form heteromultimeric acid-activated channels.
Cation channels in the DEG/ENaC family are proposed to detect cutaneous stimuli in mammals. We localized one such channel, DRASIC, in several different specialized sensory nerve endings of skin, suggesting it might participate in mechanosensation and/or acid-evoked nociception. Disrupting the mouse DRASIC gene altered sensory transduction in specific and distinct ways. Loss of DRASIC increased the sensitivity of mechanoreceptors detecting light touch, but it reduced the sensitivity of a mechanoreceptor responding to noxious pinch and decreased the response of acid- and noxious heat-sensitive nociceptors. The data suggest that DRASIC subunits participate in heteromultimeric channel complexes in sensory neurons. Moreover, in different cellular contexts, DRASIC may respond to mechanical stimuli or to low pH to mediate normal touch and pain sensation.
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
Acidosis is associated with inflammation and ischemia and activates cation channels in sensory neurons. Inflammation also induces expression of FMRFamidelike neuropeptides, which modulate pain. We found that neuropeptide FF (Phe-Leu-Phe-Gln-Pro-Gln-Arg-Phe amide) and FMRFamide (Phe-Met-Arg-Phe amide) generated no current on their own but potentiated H+-gated currents from cultured sensory neurons and heterologously expressed ASIC and DRASIC channels. The neuropeptides slowed inactivation and induced sustained currents during acidification. The effects were specific; different channels showed distinct responses to the various peptides. These results suggest that acid-sensing ion channels may integrate multiple extracellular signals to modify sensory perception.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.