Accn3 | GeneID:171209 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 171209 Official Symbol Accn3
Locus N/A Gene Type protein-coding
Synonyms ASIC3; AW742291; DRASIC; SLNAC1; TNAC1
Full Name amiloride-sensitive cation channel 3
Description amiloride-sensitive cation channel 3
Chromosome 5 A3
Also Known As
Summary N/A

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma S5070 Anti-Sodium Channel ASIC3 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0016021 Component integral to membrane
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005261 Function cation channel activity
GO:0005216 Function ion channel activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0006812 Process cation transport
GO:0050907 Process detection of chemical stimulus involved in sensory perception
GO:0050968 Process detection of chemical stimulus involved in sensory perception of pain
GO:0050974 Process detection of mechanical stimulus involved in sensory perception
GO:0050966 Process detection of mechanical stimulus involved in sensory perception of pain
GO:0050961 Process detection of temperature stimulus involved in sensory perception
GO:0050965 Process detection of temperature stimulus involved in sensory perception of pain
GO:0006811 Process ion transport
GO:0001101 Process response to acid
GO:0009408 Process response to heat
GO:0009612 Process response to mechanical stimulus
GO:0006814 Process sodium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_183000  UCSC Browser NP_892045

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000049346 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSMUST00000049346 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSMUST00000049346 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENSMUST00000049346 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSMUST00000049346 MI0000609 mmu-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENSMUST00000049346 MI0000615 mmu-miR-337-5p GAACGGCGUCAUGCAGGAGUU
ENSMUST00000049346 MI0004965 mmu-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSMUST00000049346 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ikeuchi M, et al. (2009) "Acid-sensing ion channel 3 expression in mouse knee joint afferents and effects of carrageenan-induced arthritis." J Pain. 10(3):336-342. PMID:19185546
  2. [ + ] Burnes LA, et al. (2008) "Enhanced muscle fatigue occurs in male but not female ASIC3-/- mice." Am J Physiol Regul Integr Comp Physiol. 294(4):R1347-R1355. PMID:18305024
  3. [ + ] Bielefeldt K, et al. (2008) "Differential effects of ASIC3 and TRPV1 deletion on gastroesophageal sensation in mice." Am J Physiol Gastrointest Liver Physiol. 294(1):G130-G138. PMID:17975130
  4. [ + ] Huang SJ, et al. (2008) "Increase of insulin sensitivity and reversal of age-dependent glucose intolerance with inhibition of ASIC3." Biochem Biophys Res Commun. 371(4):729-734. PMID:18466760
  5. [ + ] Ikeuchi M, et al. (2008) "Role of ASIC3 in the primary and secondary hyperalgesia produced by joint inflammation in mice." Pain. 137(3):662-669. PMID:18343037
  6. [ + ] Lin YW, et al. (2008) "Identification and characterization of a subset of mouse sensory neurons that express acid-sensing ion channel 3." Neuroscience. 151(2):544-557. PMID:18082972
  7. [ + ] Jones RC 3rd, et al. (2007) "Short-term sensitization of colon mechanoreceptors is associated with long-term hypersensitivity to colon distention in the mouse." Gastroenterology. 133(1):184-194. PMID:17553498
  8. [ + ] Huang CW, et al. (2007) "Nociceptors of dorsal root ganglion express proton-sensing G-protein-coupled receptors." Mol Cell Neurosci. 36(2):195-210. PMID:17720533
  9. [ + ] Sluka KA, et al. (2007) "ASIC3 in muscle mediates mechanical, but not heat, hyperalgesia associated with muscle inflammation." Pain. 129(1-2):102-112. PMID:17134831
  10. [ + ] Page AJ, et al. (2007) "Acid sensing ion channels 2 and 3 are required for inhibition of visceral nociceptors by benzamil." Pain. 133(1-3):150-160. PMID:17467171
  11. [ + ] Hughes PA, et al. (2007) "Localization and comparative analysis of acid-sensing ion channel (ASIC1, 2, and 3) mRNA expression in mouse colonic sensory neurons within thoracolumbar dorsal root ganglia." J Comp Neurol. 500(5):863-875. PMID:17177258
  12. [ + ] Yudin YK, et al. (2006) "Peripherally applied neuropeptide SF is equally algogenic in wild type and ASIC3-/- mice." Neurosci Res. 55(4):421-425. PMID:16730827
  13. [ + ] Chen CL, et al. (2006) "Runx1 determines nociceptive sensory neuron phenotype and is required for thermal and neuropathic pain." Neuron. 49(3):365-377. PMID:16446141
  14. [ + ] Jones RC 3rd, et al. (2005) "The mechanosensitivity of mouse colon afferent fibers and their sensitization by inflammatory mediators require transient receptor potential vanilloid 1 and acid-sensing ion channel 3." J Neurosci. 25(47):10981-10989. PMID:16306411
  15. [ + ] Mogil JS, et al. (2005) "Transgenic expression of a dominant-negative ASIC3 subunit leads to increased sensitivity to mechanical and inflammatory stimuli." J Neurosci. 25(43):9893-9901. PMID:16251436
  16. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  17. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  18. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  19. [ + ] Deval E, et al. (2004) "ASIC2b-dependent regulation of ASIC3, an essential acid-sensing ion channel subunit in sensory neurons via the partner protein PICK-1." J Biol Chem. 279(19):19531-19539. PMID:14976185
  20. [ + ] Drew LJ, et al. (2004) "Acid-sensing ion channels ASIC2 and ASIC3 do not contribute to mechanically activated currents in mammalian sensory neurones." J Physiol. 556(Pt 3):691-710. PMID:14990679
  21. [ + ] Hildebrand MS, et al. (2004) "Characterisation of DRASIC in the mouse inner ear." Hear Res. 190(1-2):149-160. PMID:15051137
  22. [ + ] Hruska-Hageman AM, et al. (2004) "PSD-95 and Lin-7b interact with acid-sensing ion channel-3 and have opposite effects on H+- gated current." J Biol Chem. 279(45):46962-46968. PMID:15317815
  23. [ + ] Chu XP, et al. (2004) "Subunit-dependent high-affinity zinc inhibition of acid-sensing ion channels." J Neurosci. 24(40):8678-8689. PMID:15470133
  24. [ + ] Price MP, et al. (2004) "Stomatin modulates gating of acid-sensing ion channels." J Biol Chem. 279(51):53886-53891. PMID:15471860
  25. [ + ] Sluka KA, et al. (2003) "Chronic hyperalgesia induced by repeated acid injections in muscle is abolished by the loss of ASIC3, but not ASIC1." Pain. 106(3):229-239. PMID:14659506
  26. [ + ] Benson CJ, et al. (2002) "Heteromultimers of DEG/ENaC subunits form H+-gated channels in mouse sensory neurons." Proc Natl Acad Sci U S A. 99(4):2338-2343. PMID:11854527
  27. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  28. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  29. [ + ] Chen CC, et al. (2002) "A role for ASIC3 in the modulation of high-intensity pain stimuli." Proc Natl Acad Sci U S A. 99(13):8992-8997. PMID:12060708
  30. [ + ] Xie J, et al. (2002) "DRASIC contributes to pH-gated currents in large dorsal root ganglion sensory neurons by forming heteromultimeric channels." J Neurophysiol. 87(6):2835-2843. PMID:12037186
  31. [ + ] Price MP, et al. (2001) "The DRASIC cation channel contributes to the detection of cutaneous touch and acid stimuli in mice." Neuron. 32(6):1071-1083. PMID:11754838
  32. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  33. [ + ] Askwith CC, et al. (2000) "Neuropeptide FF and FMRFamide potentiate acid-evoked currents from sensory neurons and proton-gated DEG/ENaC channels." Neuron. 26(1):133-141. PMID:10798398
  34. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  35. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  36. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636