Abcb1 | GeneID:170913 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 170913 Official Symbol Abcb1
Locus N/A Gene Type protein-coding
Synonyms Abcb1a; Mdr1a
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 1
Description ATP-binding cassette, sub-family B (MDR/TAP), member 1
Chromosome 4q12
Also Known As ATP-binding cassette, sub-family B (MDR/TAP), member 1A; multiple drug resistant 1a
Summary ATP-binding cassette (ABC) multiple drug transporter P-glycoprotein that is activated during liver regeneration and hepatocarcinogenesis [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55496

ID Symbol Protein Species
GeneID:5243 ABCB1 NP_000918.2 Homo sapiens
GeneID:18671 Abcb1a NP_035206.1 Mus musculus
GeneID:36582 Mdr50 NP_523740.3 Drosophila melanogaster
GeneID:170913 Abcb1 NP_596892.1 Rattus norvegicus
GeneID:178215 pgp-1 NP_502413.1 Caenorhabditis elegans
GeneID:180165 pgp-9 NP_507487.1 Caenorhabditis elegans
GeneID:281585 ABCB1 XP_590317.3 Bos taurus
GeneID:395712 ABCB1 NP_990225.1 Gallus gallus
GeneID:403879 ABCB1 NP_001003215.1 Canis lupus familiaris
GeneID:420534 ABCB4 XP_418636.2 Gallus gallus
GeneID:463516 ABCB1 XP_001163342.1 Pan troglodytes
GeneID:822463 AT3G28345 NP_189475.1 Arabidopsis thaliana
GeneID:822465 PGP16 NP_189477.1 Arabidopsis thaliana
GeneID:822467 PGP17 NP_189479.1 Arabidopsis thaliana
GeneID:822468 PGP18 NP_189480.1 Arabidopsis thaliana
GeneID:822471 AT3G28415 NP_683599.1 Arabidopsis thaliana
GeneID:2538709 pmd1 NP_588265.1 Schizosaccharomyces pombe
GeneID:2675205 MGG_00141 XP_369103.2 Magnaporthe grisea
GeneID:4328568 Os02g0190000 NP_001046147.1 Oryza sativa
GeneID:4328570 Os02g0190300 NP_001046148.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009986 Component cell surface
GO:0005575 Component cellular_component
GO:0016021 Component integral to membrane
GO:0046581 Component intercellular canaliculus
GO:0016887 Function ATPase activity
GO:0042623 Function ATPase activity, coupled
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0003674 Function molecular_function
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0015893 Process drug transport
GO:0046686 Process response to cadmium ion
GO:0042493 Process response to drug
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_133401  UCSC Browser NP_596892

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000011166 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENSRNOT00000011166 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSRNOT00000011166 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSRNOT00000011166 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSRNOT00000011166 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSRNOT00000011166 MI0005002 mmu-miR-490 CAACCUGGAGGACUCCAUGCUG
ENSRNOT00000011166 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENSRNOT00000011166 MI0000965 rno-miR-291a-3p AAAGUGCUUCCACUUUGUGUGCC
ENSRNOT00000011166 MI0000870 rno-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENSRNOT00000011166 MI0000867 rno-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENSRNOT00000011166 MI0000591 rno-miR-323 CACAUUACACGGUCGACCUCU
ENSRNOT00000011166 MI0000631 rno-miR-345-5p UGCUGACCCCUAGUCCAGUGC
ENSRNOT00000011166 MI0003528 rno-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSRNOT00000011166 MI0003525 rno-miR-543* AAACAUUCGCGGUGCACUUCU
ENSRNOT00000011166 MI0000884 rno-miR-99b CACCCGUAGAACCGACCUUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AF257746   AF286167   AY582535   NM_133401   S66618  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAF69007   AAK83023   AAS91649   CAA43415   EDL84318   NP_596892   Q6PSM0   Q924L6   Q9JK64  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Bankstahl JP, et al. (2008) "Resistance to antiepileptic drugs and expression of P-glycoprotein in two rat models of status epilepticus." Epilepsy Res. 82(1):70-85. PMID:18760905
  2. [ + ] Gazzin S, et al. (2008) "Differential expression of the multidrug resistance-related proteins ABCb1 and ABCc1 between blood-brain interfaces." J Comp Neurol. 510(5):497-507. PMID:18680196
  3. [ + ] Thevenod F, et al. (2007) "Cadmium induces nuclear translocation of beta-catenin and increases expression of c-myc and Abcb1a in kidney proximal tubule cells." Biometals. 20(5):807-820. PMID:17136310
  4. [ + ] Maeng HJ, et al. (2007) "Functional induction of P-glycoprotein in the blood-brain barrier of streptozotocin-induced diabetic rats: evidence for the involvement of nuclear factor-kappaB, a nitrosative stress-sensitive transcription factor, in the regulation." Drug Metab Dispos. 35(11):1996-2005. PMID:17664251
  5. [ + ] Booth-Genthe CL, et al. (2006) "Development and characterization of LLC-PK1 cells containing Sprague-Dawley rat Abcb1a (Mdr1a): comparison of rat P-glycoprotein transport to human and mouse." J Pharmacol Toxicol Methods. 54(1):78-89. PMID:16545584
  6. [ + ] Balayssac D, et al. (2005) "Patterns of P-glycoprotein activity in the nervous system during vincristine-induced neuropathy in rats." J Peripher Nerv Syst. 10(3):301-310. PMID:16221289
  7. [ + ] van Vliet E, et al. (2004) "Selective and persistent upregulation of mdr1b mRNA and P-glycoprotein in the parahippocampal cortex of chronic epileptic rats." Epilepsy Res. 60(2-3):203-213. PMID:15380564
  8. [ + ] Ortiz DF, et al. (2004) "Identification of HAX-1 as a protein that binds bile salt export protein and regulates its abundance in the apical membrane of Madin-Darby canine kidney cells." J Biol Chem. 279(31):32761-32770. PMID:15159385
  9. [ + ] Teeter LD, et al. (1993) "Activation of distinct multidrug-resistance (P-glycoprotein) genes during rat liver regeneration and hepatocarcinogenesis." Mol Carcinog. 8(2):67-73. PMID:8104413
  10. [ + ] Deuchars KL, et al. (1992) "Identification of distinct P-glycoprotein gene sequences in rat." Biochim Biophys Acta. 1130(2):157-165. PMID:1348630