A1cf | GeneID:170912 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 170912 Official Symbol A1cf
Locus N/A Gene Type protein-coding
Synonyms A1cft; Acf; Apobec-1
Full Name APOBEC1 complementation factor
Description APOBEC1 complementation factor
Chromosome 1q52
Also Known As APOBEC1 complementation factort; Apobec-1 complementation factor APOBEC-1 stimulating protein; Apobec-1 complementation factor, APOBEC-1 stimulating protein
Summary complementation factor that binds to RNA in a heterochromatin-associated protein complex that edits cytidine to uridine [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16363

ID Symbol Protein Species
GeneID:29974 A1CF NP_620310.1 Homo sapiens
GeneID:69865 A1cf NP_001074543.1 Mus musculus
GeneID:170912 A1cf NP_596891.1 Rattus norvegicus
GeneID:423680 A1CF XP_421561.2 Gallus gallus
GeneID:466076 A1CF XP_001162517.1 Pan troglodytes
GeneID:477581 A1CF XP_534776.2 Canis lupus familiaris
GeneID:562916 a1cf XP_685178.1 Danio rerio
GeneID:613704 A1CF XP_869839.2 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030895 Component apolipoprotein B mRNA editing enzyme complex
GO:0005737 Component cytoplasm
GO:0005720 Component nuclear heterochromatin
GO:0004131 Function cytosine deaminase activity
GO:0003725 Function double-stranded RNA binding
GO:0003729 Function mRNA binding
GO:0005515 Function protein binding
GO:0003727 Function single-stranded RNA binding
GO:0016556 Process mRNA modification
GO:0050821 Process protein stabilization

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_133400  UCSC Browser NP_596891

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000052256 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000052256 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000052256 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSRNOT00000052256 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENSRNOT00000052256 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSRNOT00000052256 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENSRNOT00000052256 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSRNOT00000052256 MI0000177 mmu-miR-155 UUAAUGCUAAUUGUGAUAGGGGU
ENSRNOT00000052256 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSRNOT00000052256 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSRNOT00000052256 MI0000898 rno-miR-126* CAUUAUUACUUUUGGUACGCG
ENSRNOT00000052256 MI0000899 rno-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSRNOT00000052256 MI0000903 rno-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSRNOT00000052256 MI0000904 rno-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSRNOT00000052256 MI0000908 rno-miR-135a* UGUAGGGAUGGAAGCCAUGAAA
ENSRNOT00000052256 MI0000611 rno-miR-140* UACCACAGGGUAGAACCACGG
ENSRNOT00000052256 MI0000933 rno-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSRNOT00000052256 MI0006135 rno-miR-190b UGAUAUGUUUGAUAUUAGGUU
ENSRNOT00000052256 MI0000862 rno-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENSRNOT00000052256 MI0000589 rno-miR-322* AAACAUGAAGCGCUGCAACA
ENSRNOT00000052256 MI0000591 rno-miR-323 CACAUUACACGGUCGACCUCU
ENSRNOT00000052256 MI0001656 rno-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSRNOT00000052256 MI0006141 rno-miR-380 AUGGUUGACCAUAGAACAUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lehmann DM, et al. (2007) "Functional characterization of APOBEC-1 complementation factor phosphorylation sites." Biochim Biophys Acta. 1773(3):408-418. PMID:17229474
  2. [ + ] Blanc V, et al. (2005) "Targeted deletion of the murine apobec-1 complementation factor (acf) gene results in embryonic lethality." Mol Cell Biol. 25(16):7260-7269. PMID:16055734
  3. [ + ] Sowden MP, et al. (2004) "Identification of novel alternative splice variants of APOBEC-1 complementation factor with different capacities to support apolipoprotein B mRNA editing." J Biol Chem. 279(1):197-206. PMID:14570923
  4. [ + ] Petersen-Mahrt SK, et al. (2003) "In vitro deamination of cytosine to uracil in single-stranded DNA by apolipoprotein B editing complex catalytic subunit 1 (APOBEC1)." J Biol Chem. 278(22):19583-19586. PMID:12697753
  5. [ + ] Apostel F, et al. (2002) "Reduced expression and increased CpG dinucleotide methylation of the rat APOBEC-1 promoter in transgenic rabbits." Biochim Biophys Acta. 1577(3):384-394. PMID:12359328
  6. [ + ] Sowden MP, et al. (2002) "The editosome for cytidine to uridine mRNA editing has a native complexity of 27S: identification of intracellular domains containing active and inactive editing factors." J Cell Sci. 115(Pt 5):1027-1039. PMID:11870221
  7. [ + ] Lellek H, et al. (2000) "Purification and molecular cloning of a novel essential component of the apolipoprotein B mRNA editing enzyme-complex." J Biol Chem. 275(26):19848-19856. PMID:10781591