ACE | GeneID:1636 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 1636 Official Symbol ACE
Locus N/A Gene Type protein-coding
Synonyms ACE1; CD143; DCP; DCP1; MGC26566; MVCD3
Full Name angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
Description angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
Chromosome 17q23.3
Also Known As CD143 antigen; angiotensin I converting enzyme 1; angiotensin converting enzyme, somatic isoform; carboxycathepsin; dipeptidyl carboxypeptidase 1; kininase II; peptidase P; testicular ECA
Summary This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Two most abundant alternatively spliced variants of this gene encode two isozymes - the somatic form and the testicular form that are equally active. Multiple additional alternatively spliced variants have been identified but their full length nature has not been determined. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37351

ID Symbol Protein Species
GeneID:1636 ACE NP_000780.1 Homo sapiens
GeneID:11421 Ace NP_997507.1 Mus musculus
GeneID:24310 Ace NP_036676.1 Rattus norvegicus
GeneID:419953 ACE XP_418074.2 Gallus gallus
GeneID:449567 ACE NP_001008995.1 Pan troglodytes
GeneID:565980 wu:fb81h03 XP_694336.3 Danio rerio
GeneID:610668 ACE XP_548035.2 Canis lupus familiaris
GeneID:1274704 ANCE9 XP_313865.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab11738 Angiotensin Converting Enzyme 1 antibody [ 9B9] (ab11738); Mouse monoclonal [ 9B9] to Angiotensin Converting Enzyme 1
2 abcam ab11740 Angiotensin Converting Enzyme 1 antibody [9B9] (FITC) (ab11740); Mouse monoclonal [9B9] to Angiotensin Converting Enzyme 1 (FITC)
3 abcam ab11739 Angiotensin Converting Enzyme 1 antibody [9B9] (Biotin) (ab11739); Mouse monoclonal [9B9] to Angiotensin Converting Enzyme 1 (Biotin)
4 abcam ab39172 Angiotensin Converting Enzyme 1 antibody - Carboxyterminal end (ab39172); Rabbit polyclonal to Angiotensin Converting Enzyme 1 - Carboxyterminal end
5 abcam ab33318 Angiotensin Converting Enzyme 1 antibody [9B9] (Phycoerythrin) (ab33318); Mouse monoclonal [9B9] to Angiotensin Converting Enzyme 1 (Phycoerythrin)
6 abcam ab33305 Angiotensin Converting Enzyme 1 antibody [i2H5] (Phycoerythrin) (ab33305); Mouse monoclonal [i2H5] to Angiotensin Converting Enzyme 1 (Phycoerythrin)
7 abcam ab28311 Angiotensin Converting Enzyme 1 antibody - Aminoterminal end catalytic domain (ab28311); Rabbit polyclonal to Angiotensin Converting Enzyme 1 - Aminoterminal end catalytic domain
8 abcam ab28313 Angiotensin Converting Enzyme 1 antibody - Carboxyterminal end catalytic domain (ab28313); Rabbit polyclonal to Angiotensin Converting Enzyme 1 - Carboxyterminal end catalytic domain
9 abcam ab28325 Angiotensin Converting Enzyme 1 antibody - Cytoplasmic domain (ab28325); Rabbit polyclonal to Angiotensin Converting Enzyme 1 - Cytoplasmic domain
10 abcam ab11709 Angiotensin Converting Enzyme 1 antibody [ i1A8] (FITC) (ab11709); Mouse monoclonal [ i1A8] to Angiotensin Converting Enzyme 1 (FITC)
11 abcam ab11735 Angiotensin Converting Enzyme 1 antibody [i2H5] (Biotin) (ab11735); Mouse monoclonal [i2H5] to Angiotensin Converting Enzyme 1 (Biotin)
12 abcam ab11736 Angiotensin Converting Enzyme 1 antibody [i2H5] (FITC) (ab11736); Mouse monoclonal [i2H5] to Angiotensin Converting Enzyme 1 (FITC)
13 abcam ab2092 Angiotensin Converting Enzyme 1 antibody [M4110421] (ab2092); Mouse monoclonal [M4110421] to Angiotensin Converting Enzyme 1
14 abcam ab11734 Angiotensin Converting Enzyme 1 antibody [2E2] (ab11734); Mouse monoclonal [2E2] to Angiotensin Converting Enzyme 1
15 abcam ab11737 Angiotensin Converting Enzyme 1 antibody [3C5] (ab11737); Mouse monoclonal [3C5] to Angiotensin Converting Enzyme 1
16 abcam ab20054 Angiotensin Converting Enzyme 1 antibody [501] (ab20054); Mouse monoclonal [501] to Angiotensin Converting Enzyme 1
17 abgent AP7793b ACE Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
18 abnova H00001636-M02 ACE monoclonal antibody (M02), clone 4B10; Mouse monoclonal antibody raised against a partial recombinant ACE.
19 abnova H00001636-M01 ACE monoclonal antibody (M01), clone 6A4; Mouse monoclonal antibody raised against a partial recombinant ACE.
20 acris BM2179 ACE / CD143; antibody Ab
21 acris SM1657 ACE / CD143; antibody Ab
22 acris SM1655 ACE / CD143; antibody Ab
23 acris SM1658 ACE / CD143; antibody Ab
24 acris SM1656B ACE / CD143; antibody Ab
25 acris SM1658B ACE / CD143; antibody Ab
26 acris BM4055 ACE / CD143; antibody Ab
27 acris SM1656R ACE / CD143; antibody Ab
28 acris SM1656 ACE / CD143; antibody Ab
29 acris SM1658R ACE / CD143; antibody Ab
30 acris SM2072R ACE / CD143; antibody Ab
31 acris AP14588PU-N ACE / CD143 (C-term); antibody Ab
32 acris SM1656F ACE / CD143; antibody Ab
33 acris SM1658F ACE / CD143; antibody Ab
34 acris SM2072F ACE / CD143; antibody Ab
35 scbt ACE ACE Antibody / ACE Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACE Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACE Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005768 Component endosome
GO:0009897 Component external side of plasma membrane
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0016021 Component integral to membrane
GO:0005624 Component membrane fraction
GO:0005886 Component plasma membrane
GO:0031711 Function bradykinin receptor binding
GO:0004180 Function carboxypeptidase activity
GO:0031404 Function chloride ion binding
GO:0008144 Function drug binding
GO:0046872 Function metal ion binding
GO:0008237 Function metallopeptidase activity
GO:0008233 Function peptidase activity
GO:0008241 Function peptidyl-dipeptidase activity
GO:0008270 Function zinc ion binding
GO:0002005 Process angiotensin catabolic process in blood
GO:0050482 Process arachidonic acid secretion
GO:0060218 Process hemopoietic stem cell differentiation
GO:0042447 Process hormone catabolic process
GO:0001822 Process kidney development
GO:0032943 Process mononuclear cell proliferation
GO:0043171 Process peptide catabolic process
GO:0006508 Process proteolysis
GO:0008217 Process regulation of blood pressure
GO:0014910 Process regulation of smooth muscle cell migration
GO:0003081 Process regulation of systemic arterial blood pressure by renin-angiotensin
GO:0019229 Process regulation of vasoconstriction
GO:0042312 Process regulation of vasodilation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000789  UCSC Browser NP_000780
2 NM_152830  UCSC Browser NP_690043

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000290866 MI0000443 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000290866 MI0000444 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000290866 MI0000445 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000290866 MI0000452 hsa-miR-135a* UAUAGGGAUUGGAGCCGUGGCG
ENST00000290866 MI0000455 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000290866 MI0000476 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000290866 MI0000478 hsa-miR-149* AGGGAGGGACGGGGGCUGUGC
ENST00000290866 MI0000482 hsa-miR-185* AGGGGCUGGCUUUCCUCUGGUC
ENST00000290866 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENST00000290866 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000290866 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000290866 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000290866 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000290866 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENST00000290866 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000290866 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000290866 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000290866 MI0000736 hsa-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENST00000290866 MI0000254 hsa-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENST00000290866 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENST00000290866 MI0000802 hsa-miR-340* UCCGUCUCAGUUACUUUAUAGC
ENST00000290866 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000290866 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000290866 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENST00000290866 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000290866 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENST00000290866 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENST00000290866 MI0003159 hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG
ENST00000290866 MI0003556 hsa-miR-551a GCGACCCACUCUUGGUUUCCA
ENST00000290866 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000290866 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000290866 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENST00000290866 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENST00000290866 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000290866 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENST00000290866 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000290866 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000290866 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENST00000290866 MI0000093 hsa-miR-92a-1* AGGUUGGGAUCGGUUGCAAUGCU
ENST00000290866 MI0000094 hsa-miR-92a-2* GGGUGGGGAUUUGUUGCAUUAC
ENST00000290866 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENST00000290866 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000290866 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000290866 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000290866 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000290866 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000290866 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENST00000290866 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENST00000290866 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENST00000290866 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENST00000290866 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENST00000290866 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENST00000290866 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000290866 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENST00000290866 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENST00000290866 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AB208971   AK296566   AK300516   AK301988   AK302019   AK309514   BC036375   BM908180   J04144   M26657   M29981   NM_000789   NM_152830   S81361   X16295  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
AG 1879
  • AG 1879 inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
15932931
Aldosterone
  • AG 1879 inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
  • Aldosterone results in increased activity of ACE protein
  • Aldosterone results in increased expression of ACE mRNA
  • Dactinomycin inhibits the reaction [Aldosterone results in increased activity of ACE protein]
  • Dactinomycin inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
  • Genistein inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
  • Spironolactone inhibits the reaction [Aldosterone results in increased activity of ACE protein]
  • Spironolactone inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
  • alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
  • tyrphostin AG 1478 inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
15932931
alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide
  • alpha-cyano-(3,4-dihydroxy)-N-benzylcinnamide inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
15932931
Aluminum
  • Aluminum results in decreased activity of ACE protein
12008977
Angiotensin-Converting Enzyme Inhibitors
  • Angiotensin-Converting Enzyme Inhibitors results in decreased activity of ACE protein
15667801
benazepril
  • benazepril results in decreased activity of ACE protein
16364833
caffeic acid
  • caffeic acid does not affect the activity of ACE protein
16390204
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ACE protein
12629582
Catechin
  • Catechin does not affect the activity of ACE protein
  • Catechin does not affect the activity of ACE protein
16390204
CGS 35601
  • CGS 35601 results in decreased activity of ACE protein
16364833
Chlorogenic Acid
  • Chlorogenic Acid does not affect the activity of ACE protein
16390204
Corticosterone
  • Corticosterone results in increased expression of ACE mRNA
15755911
Curcumin
  • Curcumin inhibits the reaction [Paraquat affects the expression of ACE protein]
10666014
Dactinomycin
  • Dactinomycin inhibits the reaction [Aldosterone results in increased activity of ACE protein]
  • Dactinomycin inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
15932931
Dexamethasone
  • Dexamethasone results in increased expression of ACE mRNA
  • Mifepristone inhibits the reaction [Dexamethasone results in increased expression of ACE mRNA]
15932931
Enalapril
  • Enalapril results in decreased activity of ACE protein
16327016
Enalapril
  • Enalapril results in decreased activity of ACE protein
15816410
Estrogens, Conjugated (USP)
  • Estrogens, Conjugated (USP) results in decreased activity of ACE protein
11345361
Flavonoids
  • Flavonoids results in decreased expression of ACE mRNA
18035473
Gallic Acid
  • Gallic Acid does not affect the activity of ACE protein
16390204
gallocatechol
  • gallocatechol results in decreased activity of ACE protein
16390204
Genistein
  • Genistein inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
15932931
hippuryl-histidyl-leucine
  • ACE protein affects the metabolism of hippuryl-histidyl-leucine
15932931
imidaprilat
  • imidaprilat results in decreased activity of ACE protein
16406270
kaempferol
  • kaempferol does not affect the activity of ACE protein
16390204
Mifepristone
  • Mifepristone inhibits the reaction [Dexamethasone results in increased expression of ACE mRNA]
15932931
Nitric Oxide
  • ACE protein inhibits the reaction [KNG1 protein results in increased abundance of Nitric Oxide]
12672649
omapatrilat
  • omapatrilat results in decreased activity of ACE protein
11762555
Paraquat
  • Curcumin inhibits the reaction [Paraquat affects the expression of ACE protein]
  • Paraquat affects the expression of ACE protein
10666014
Paraquat
  • Paraquat results in decreased activity of ACE protein
16182431
Paraquat
  • Paraquat results in decreased activity of ACE protein
15297733
Paraquat
  • Paraquat results in decreased activity of ACE protein
  • pimagedine inhibits the reaction [Paraquat results in decreased activity of ACE protein]
12161173
pimagedine
  • pimagedine inhibits the reaction [Paraquat results in decreased activity of ACE protein]
12161173
pirinixic acid
  • pirinixic acid results in decreased expression of ACE mRNA
17426115
Proanthocyanidins
  • Proanthocyanidins results in decreased activity of ACE protein
  • Proanthocyanidins results in decreased activity of ACE protein
16390204
Quercetin
  • Quercetin does not affect the activity of ACE protein
16390204
Raloxifene
  • Raloxifene results in decreased expression of ACE mRNA
15849065
resveratrol
  • resveratrol does not affect the activity of ACE protein
16390204
Spironolactone
  • Spironolactone inhibits the reaction [Aldosterone results in increased activity of ACE protein]
  • Spironolactone inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
15932931
tyrphostin AG 1478
  • tyrphostin AG 1478 inhibits the reaction [Aldosterone results in increased expression of ACE mRNA]
15932931
Zinc
  • Zinc results in decreased activity of ACE protein
17114810

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alzheimer Disease marker
Anuria marker
Cardiovascular Diseases marker 11498459
Central Nervous System Diseases marker
Coronary Artery Disease marker 14989558
Diabetic Nephropathies marker
Glomerulonephritis, IGA marker
Myocardial Infarction marker
Pre-Eclampsia marker 17114810
Prostatic Neoplasms marker 17465223
RENAL TUBULAR DYSGENESIS marker
Stroke marker
Acrodermatitis inferred via Zinc 17190629, 16889938, 17202136
Alzheimer Disease inferred via Zinc 17119284, 16410023, 16325427, 16580781
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16700911, 16606632, 16517595
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 16393696, 17534123
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 16267019, 17935668, 17164350, 16490592, 17049120
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 17125593, 16456233, 16317513, 17015251, 16525036
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 17636462, 17718901, 17804756, 15767336, 16731767
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 16314181, 16317513, 15827377
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15758505, 17595753, 16837676, 17440819, 15775269, 16912660, 17893378, 17952589, 17261762, 15572757, 17049068
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 17893378, 17823083, 15579764
Prostatic Neoplasms inferred via Raloxifene 16220300, 15731164, 16536755
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Cadmium Poisoning inferred via Quercetin 16962696
Influenza, Human inferred via Quercetin 16624496
Kidney Diseases inferred via Quercetin 16962696
Liver Cirrhosis, Experimental inferred via Quercetin 12741479
Neurogenic Inflammation inferred via Quercetin 17929310
Pancreatic Neoplasms inferred via Quercetin 16965848
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 11445065, 16510128, 15451049, 11124998, 16140633, 15824117, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Alzheimer Disease inferred via Nitric Oxide 17556102
Breast Neoplasms inferred via Nitric Oxide 15631943
Cholestasis inferred via Nitric Oxide 16919318
Dementia, Vascular inferred via Nitric Oxide 17556102
Hypertension, Pulmonary inferred via Nitric Oxide 15838368
Intestinal Diseases inferred via Nitric Oxide 10210152
Lymphoma inferred via Nitric Oxide 16166326
Endometriosis inferred via Mifepristone 16134523
Ovarian Neoplasms inferred via Mifepristone 16525653
Breast Neoplasms inferred via kaempferol 16756079
Cardiovascular Diseases inferred via kaempferol 16756079
Osteoporosis inferred via kaempferol 16756079
Breast Neoplasms inferred via Genistein 17200150, 16873071, 16541309
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15256057, 15378649
Inflammation inferred via Flavonoids 17296493
Cough inferred via Enalapril 11725383
Heart Failure inferred via Enalapril 10979640, 12514674
Liver Cirrhosis, Experimental inferred via Enalapril 17347453
Pulmonary Fibrosis inferred via Enalapril 17265423
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 15744524, 16118317
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Bone Marrow Neoplasms inferred via Dactinomycin 14601052
Sarcoma, Ewing's inferred via Dactinomycin 14601052
Breast Neoplasms inferred via Curcumin 16243823
Inflammation inferred via Curcumin 16956363, 17151092
Leukemia-Lymphoma, Adult T-Cell inferred via Curcumin 16106398
Leukemia, T-Cell inferred via Curcumin 16106398
Liver Cirrhosis, Experimental inferred via Curcumin 18006644
Liver Diseases inferred via Curcumin 16956363
Lung Neoplasms inferred via Curcumin 16243823
Lymphoma, T-Cell inferred via Curcumin 16173963
Memory Disorders inferred via Curcumin 17263510
Muscular Atrophy, Spinal inferred via Curcumin 17962980
Respiratory Distress Syndrome, Adult inferred via Curcumin 10666014
Mammary Neoplasms, Experimental inferred via Corticosterone 12807724
Hypertension inferred via CGS 35601 16364833
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15700767, 16124888, 16227642, 10355542, 16050911, 15673190, 16011737, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 61145, 12631006, 16239168, 17595544, 15959796, 12795759
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15998439, 15968718, 15027814, 16227642, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 17334410, 16239168, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17557913, 17805973, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 15925388, 16248980, 16116963, 17525996
Liver Diseases inferred via Carbon Tetrachloride 16246199, 17285989, 15830285, 16964402, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Alzheimer Disease inferred via Aluminum 10721010
Inflammation inferred via Aluminum 16052892
Lung Diseases inferred via Aluminum 16052892
Multiple Sclerosis, Chronic Progressive inferred via Aluminum 17086897
Multiple Sclerosis, Relapsing-Remitting inferred via Aluminum 17086897

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Dell'Omo G, et al. (2009) "Lack of association between TGF-beta-1 genotypes and microalbuminuria in essential hypertensive men." Nephrol Dial Transplant. 24(6):1864-1869. PMID:19176688
  2. [ + ] Vardy ER, et al. (2009) "Plasma angiotensin-converting enzyme in Alzheimer's disease." J Alzheimers Dis. 16(3):609-618. PMID:19276555
  3. [ + ] Smith AK, et al. (2009) "An angiotensin-1 converting enzyme polymorphism is associated with allostatic load mediated by C-reactive protein, interleukin-6 and cortisol." Psychoneuroendocrinology. 34(4):597-606. PMID:19081678
  4. [ + ] Gurkan A, et al. (2009) "Angiotensin-converting enzyme (ACE), angiotensinogen (AGT), and angiotensin II type 1 receptor (AT1R) gene polymorphisms in generalized aggressive periodontitis." Arch Oral Biol. 54(4):337-344. PMID:19162259
  5. [ + ] Yalcin AA, et al. (2009) "The relationship between slow coronary flow and angiotensin converting enzyme and ATIIR1 gene polymorphisms." J Natl Med Assoc. 101(1):40-45. PMID:19245071
  6. [ + ] Pascuzzo-Lima C, et al. (2009) "Angiotensin-converting enzyme insertion/deletion gene polymorphism and progression of Chagas' cardiomyopathy." Rev Esp Cardiol. 62(3):320-322. PMID:19268079
  7. [ + ] Kehoe AD, et al. (2009) "Angiotensin-converting enzyme genotype and encephalopathy in Chernobyl cleanup workers." Eur J Neurol. 16(1):95-100. PMID:19018872
  8. [ + ] Joshi G, et al. (2009) "Role of the ACE ID and MTHFR C677T polymorphisms in genetic susceptibility of migraine in a north Indian population." J Neurol Sci. 277(1-2):133-137. PMID:19081115
  9. [ + ] Pehlivan S, et al. (2009) "Association between IL4 (-590), ACE (I)/(D), CCR5 (Delta32), CTLA4 (+49) and IL1-RN (VNTR in intron 2) gene polymorphisms and vitiligo." Eur J Dermatol. 19(2):126-128. PMID:19129082
  10. [ + ] Need AC, et al. (2009) "Pharmacogenetics of antipsychotic response in the CATIE trial: a candidate gene analysis." Eur J Hum Genet. 17(7):946-957. PMID:19156168
  11. [ + ] Schurks M, et al. (2009) "ACE D/I polymorphism, migraine, and cardiovascular disease in women." Neurology. 72(7):650-656. PMID:19221299
  12. [ + ] Eliseeva MR, et al. (2009) "[Genetic determinants of cardiovascular remodeling in Uzbek patients with essential hypertension]" Ter Arkh. 81(1):64-69. PMID:19253715
  13. [ + ] Zee RY, et al. (2009) "Genetic risk factors in recurrent venous thromboembolism: A multilocus, population-based, prospective approach." Clin Chim Acta. 402(1-2):189-192. PMID:19263529
  14. [ + ] Gomez-Gallego F, et al. (2009) "Endurance performance: genes or gene combinations?" Int J Sports Med. 30(1):66-72. PMID:18651373
  15. [ + ] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102
  16. [ + ] Yoshida T, et al. (2009) "Association of a polymorphism of the apolipoprotein E gene with chronic kidney disease in Japanese individuals with metabolic syndrome." Genomics. 93(3):221-226. PMID:19056482
  17. [ + ] Liu H, et al. (2009) "Association of ACE I/D gene polymorphism with vascular dementia: a meta-analysis." J Geriatr Psychiatry Neurol. 22(1):10-22. PMID:19073835
  18. [ + ] Ahluwalia TS, et al. (2009) "ACE Variants Interact with the RAS Pathway to Confer Risk and Protection against Type 2 Diabetic Nephropathy." DNA Cell Biol. 28(3):141-150. PMID:19108684
  19. [ + ] Kim K, et al. (2009) "Association of angiotensin-converting enzyme insertion/deletion polymorphism with obesity, cardiovascular risk factors and exercise-mediated changes in Korean women." Eur J Appl Physiol. 105(6):879-887. PMID:19125277
  20. [ + ] Kawajiri M, et al. (2009) "Angiotensin-converting enzyme (ACE) and ACE2 levels in the cerebrospinal fluid of patients with multiple sclerosis." Mult Scler. 15(2):262-265. PMID:19136547
  21. [ + ] Ruixing Y, et al. (2009) "The environmental and genetic evidence for the association of hyperlipidemia and hypertension." J Hypertens. 27(2):251-258. PMID:19155782
  22. [ + ] Palomo-Pinon S, et al. (2009) "DD genotype of angiotensin-converting enzyme in type 2 diabetes mellitus with renal disease in Mexican Mestizos." Nephrology (Carlton). 14(2):235-239. PMID:19207872
  23. [ + ] Brophy DF, et al. (2009) "A pilot study of genetic polymorphisms and hemodialysis vascular access thrombosis." Hemodial Int. 13(1):19-26. PMID:19210273
  24. [ + ] Gurkan A, et al. (2009) "Renin-angiotensin gene polymorphisms in relation to severe chronic periodontitis." J Clin Periodontol. 36(3):204-211. PMID:19236533
  25. [ + ] Ruiz JR, et al. (2009) "Is there an optimum endurance polygenic profile?" J Physiol. 587(Pt 7):1527-1534. PMID:19237423
  26. [ + ] Bozkurt O, et al. (2009) "Variation in Renin-Angiotensin system and salt-sensitivity genes and the risk of diabetes mellitus associated with the use of thiazide diuretics." Am J Hypertens. 22(5):545-551. PMID:19247266
  27. [ + ] Daley D, et al. (2009) "Analyses of associations with asthma in four asthma population samples from Canada and Australia." Hum Genet. 125(4):445-459. PMID:19247692
  28. [ + ] Vigano A, et al. (2009) "Relationship between angiotensin-converting enzyme gene polymorphism and body composition, functional performance, and blood biomarkers in advanced cancer patients." Clin Cancer Res. 15(7):2442-2447. PMID:19258445
  29. [ + ] Uematsu M, et al. (2009) "A further case of renal tubular dysgenesis surviving the neonatal period." Eur J Pediatr. 168(2):207-209. PMID:18478260
  30. [ + ] San Jose G, et al. (2009) "The angiotensin-converting enzyme insertion/deletion polymorphism is associated with phagocytic NADPH oxidase-dependent superoxide generation: potential implication in hypertension." Clin Sci (Lond). 116(3):233-240. PMID:18647135
  31. [ + ] Febba A, et al. (2009) "Stunting growth: association of the blood pressure levels and ACE activity in early childhood." Pediatr Nephrol. 24(2):379-386. PMID:18791745
  32. [ + ] Johnson AD, et al. (2009) "Promoter polymorphisms in ACE (angiotensin I-converting enzyme) associated with clinical outcomes in hypertension." Clin Pharmacol Ther. 85(1):36-44. PMID:18946466
  33. [ + ] Velez DR, et al. (2009) "Spontaneous preterm birth in African Americans is associated with infection and inflammatory response gene variants." Am J Obstet Gynecol. 200(2):209.e1-209.27. PMID:19019335
  34. [ + ] Kalson NS, et al. (2009) "The effect of angiotensin-converting enzyme genotype on acute mountain sickness and summit success in trekkers attempting the summit of Mt. Kilimanjaro (5,895 m)." Eur J Appl Physiol. 105(3):373-379. PMID:19030872
  35. [ + ] Suonsyrja T, et al. (2009) "Renin-angiotensin system and alpha-adducin gene polymorphisms and their relation to responses to antihypertensive drugs: results from the GENRES study." Am J Hypertens. 22(2):169-175. PMID:19057513
  36. [ + ] Feron D, et al. (2009) "Significant lower VVH7-like immunoreactivity serum level in diabetic patients: evidence for independence from metabolic control and three key enzymes in hemorphin metabolism, cathepsin D, ACE and DPP-IV." Peptides. 30(2):256-261. PMID:19061927
  37. [ + ] Brugts JJ, et al. (2009) "The rationale and design of the PERindopril GENEtic association study (PERGENE): a pharmacogenetic analysis of angiotensin-converting enzyme inhibitor therapy in patients with stable coronary artery disease." Cardiovasc Drugs Ther. 23(2):171-181. PMID:19082699
  38. [ + ] Edwards TL, et al. (2009) "An association analysis of Alzheimer disease candidate genes detects an ancestral risk haplotype clade in ACE and putative multilocus association between ACE, A2M, and LRRTM3." Am J Med Genet B Neuropsychiatr Genet. 150B(5):721-735. PMID:19105203
  39. [ + ] Taranta A, et al. (2009) "Genetic risk factors in typical haemolytic uraemic syndrome." Nephrol Dial Transplant. 24(6):1851-1857. PMID:19110485
  40. [ + ] Huang M, et al. (2009) "Functional polymorphisms in ACE and CYP11B2 genes and atrial fibrillation in patients with hypertensive heart disease." Clin Chem Lab Med. 47(1):32-37. PMID:19117407
  41. [ + ] Wang X, et al. (2009) "A meta-analysis of candidate gene polymorphisms and ischemic stroke in 6 study populations: association of lymphotoxin-alpha in nonhypertensive patients." Stroke. 40(3):683-695. PMID:19131662
  42. [ + ] Wipff J, et al. (2009) "Angiotensin-converting enzyme gene does not contribute to genetic susceptibility to systemic sclerosis in European Caucasians." J Rheumatol. 36(2):337-340. PMID:19132786
  43. [ + ] Moon JY, et al. (2009) "Arteriovenous fistula patency associated with angiotensin-converting enzyme I/D polymorphism and ACE inhibition or AT1 receptor blockade." Nephron Clin Pract. 111(2):c110-c116. PMID:19142023
  44. [ + ] Plat AW, et al. (2009) "The association between arterial stiffness and the angiotensin II type 1 receptor (A1166C) polymorphism is influenced by the use of cardiovascular medication." J Hypertens. 27(1):69-75. PMID:19145770
  45. [ + ] Duan QL, et al. (2009) "Genetic analysis of Factor XII and bradykinin catabolic enzymes in a family with estrogen-dependent inherited angioedema." J Allergy Clin Immunol. 123(4):906-910. PMID:19178938
  46. [ + ] Ozturk O, et al. (2009) "Relation between angiotensin-converting enzyme I/D gene polymorphism and pulse pressure in patients with a first anterior acute myocardial infarction." Anadolu Kardiyol Derg. 9(1):9-14. PMID:19196567
  47. [ + ] Baroudi T, et al. (2009) "Association of the insertion/deletion polymorphism of the angiotensin-converting enzyme gene with type 2 diabetes in two ethnic groups of Jerba Island in Tunisia." J Renin Angiotensin Aldosterone Syst. 10(1):35-40. PMID:19286757
  48. [ + ] Juffer P, et al. (2009) "Genotype distributions in top-level soccer players: a role for ACE?" Int J Sports Med. 30(5):387-392. PMID:19277943